peak-motifs Broad

motif discovery

oligos_6nt_mkv3

oligos_6nt_mkv3_m1	assembly: aaataaatac (sig=64.79; e-value=1.6e-65)	RC: gtatttattt
oligos_6nt_mkv3_m2	assembly: gaagaaagaag (sig=59.70; e-value=2e-60)	RC: cttctttcttc
oligos_6nt_mkv3_m3	assembly: ttgagtgagtt (sig=49.08; e-value=8.3e-50)	RC: aactcactcaa
oligos_6nt_mkv3_m4	assembly: accaaaccctaactaa (sig=45.94; e-value=1.1e-46)	RC: ttagttagggtttggt
oligos_6nt_mkv3_m5	assembly: atatata (sig=37.15; e-value=7.1e-38)	RC: tatatat

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: ttttatttatataaataaaa (sig=300; e-value=1e-300)	RC: ttttatttatataaataaaa
positions_6nt_m2	assembly: gagagagt (sig=300; e-value=1e-300)	RC: actctctc
positions_6nt_m3	assembly: tttttatttatatattatag (sig=300; e-value=1e-300)	RC: ctataatatataaataaaaa
positions_6nt_m4	assembly: tttatttatataataaataa (sig=300; e-value=1e-300)	RC: ttatttattatataaataaa
positions_6nt_m5	assembly: ataatttatttaaataaatt (sig=300; e-value=1e-300)	RC: aatttatttaaataaattat

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv4

oligos_7nt_mkv4_m1	assembly: aaaccctag (sig=63.87; e-value=1.3e-64)	RC: ctagggttt
oligos_7nt_mkv4_m2	assembly: aaacaaaacc (sig=32.41; e-value=3.9e-33)	RC: ggttttgttt
oligos_7nt_mkv4_m3	assembly: ctataaatac (sig=27.70; e-value=2e-28)	RC: gtatttatag
oligos_7nt_mkv4_m4	assembly: gagaaagag (sig=19.84; e-value=1.4e-20)	RC: ctctttctc
oligos_7nt_mkv4_m5	assembly: acacaacacaa (sig=18.47; e-value=3.4e-19)	RC: ttgtgttgtgt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: tttatttatatataaataaa (sig=300; e-value=1e-300)	RC: tttatttatatataaataaa
positions_7nt_m2	assembly: gagagagaaagaaag (sig=65.31; e-value=4.9e-66)	RC: ctttctttctctctc
positions_7nt_m3	assembly: actatatataaataaattta (sig=300; e-value=1e-300)	RC: taaatttatttatatatagt
positions_7nt_m4	assembly: taaatttatttatataaaaa (sig=300; e-value=1e-300)	RC: tttttatataaataaattta
positions_7nt_m5	assembly: atttatttataaataaattt (sig=72.10; e-value=7.9e-73)	RC: aaatttatttataaataaat

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv3_m1

k-mer sig=64.79; evalue=1.6e-65

atawATAwATAtat

ATATATWTATWTAT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 734 (9.47%)
Max nb of predicted sites per peak: 32
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 3.54

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv3_m2

k-mer sig=59.70; evalue=2e-60

rrGaAGAaaGAarrr

YYYTTCTTTCTTCYY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 818 (10.56%)
Max nb of predicted sites per peak: 5
(GWHCAYC00000020:46458313-46458414(-))
Mean nb of predicted sites per peak: 1.28

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv3_m3

k-mer sig=49.08; evalue=8.3e-50

gdkTGaGTGaGTkdg

CHMACTCACTCAMHC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 949 (12.25%)
Max nb of predicted sites per peak: 13
(GWHCAYC00000016:34647492-34647593(-))
Mean nb of predicted sites per peak: 1.98

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv3_m4

k-mer sig=45.94; evalue=1.1e-46

mmaCCaAACCCTaaCtaamm

KKTTAGTTAGGGTTTGGTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 334 (4.31%)
Max nb of predicted sites per peak: 4
(GWHCAYC00000004:51783972-51784073(-))
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv3_m5

k-mer sig=37.15; evalue=7.1e-38

wtaTATATata

TATATATATAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 599 (7.73%)
Max nb of predicted sites per peak: 32
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 4.78

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=300; evalue=1e-300

wtwtwTaTwTATATAtATawawat

ATWTWTATATATATAWATAWAWAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 365 (4.71%)
Max nb of predicted sites per peak: 35
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 7.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=300; evalue=1e-300

GaGAGAGAGaGr

YCTCTCTCTCTC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1412 (18.22%)
Max nb of predicted sites per peak: 18
(GWHCAYC00000016:32539765-32539866(-))
Mean nb of predicted sites per peak: 2.99

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=300; evalue=1e-300

twtwTwTaTwTaTaTaTwwwwrtw

WAYWWWWATATATAWATAWAWAWA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 625 (8.07%)
Max nb of predicted sites per peak: 34
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 4.85

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=300; evalue=1e-300

twtwTaTwTaTaTaataaataaww

WWTTATTTATTATATAWATAWAWA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 580 (7.48%)
Max nb of predicted sites per peak: 30
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 4.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=300; evalue=1e-300

tatwtaTwTATaTATATAtATata

TATATATATATATATAWATAWATA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 290 (3.74%)
Max nb of predicted sites per peak: 35
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 6.66

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv4_m1

k-mer sig=63.87; evalue=1.3e-64

cmaAACCCTAgyy

RRCTAGGGTTTKG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 430 (5.55%)
Max nb of predicted sites per peak: 4
(GWHCAYC00000004:51783972-51784073(-))
Mean nb of predicted sites per peak: 1.09

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv4_m2

k-mer sig=32.41; evalue=3.9e-33

mmaaaCaAAACCmm

KKGGTTTTGTTTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 362 (4.67%)
Max nb of predicted sites per peak: 3
(GWHCAYC00000011:4122945-4123046(+))
Mean nb of predicted sites per peak: 1.09

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv4_m3

k-mer sig=27.70; evalue=2e-28

atmTATAwATAyat

ATRTATWTATAKAT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 692 (8.93%)
Max nb of predicted sites per peak: 32
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 3.79

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv4_m4

k-mer sig=19.84; evalue=1.4e-20

GaGAGArAGAGaG

CTCTCTYTCTCTC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1325 (17.10%)
Max nb of predicted sites per peak: 18
(GWHCAYC00000016:32539765-32539866(-))
Mean nb of predicted sites per peak: 3.13

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv4_m5

k-mer sig=18.47; evalue=3.4e-19

mmaCaCaaCaCaamm

KKTTGTGTTGTGTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 538 (6.94%)
Max nb of predicted sites per peak: 6
(GWHCAYC00000009:1953708-1953809(-))
Mean nb of predicted sites per peak: 1.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=300; evalue=1e-300

twtwtaTwTaTATATawatawata

TATWTATWTATATATAWATAWAWA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 451 (5.82%)
Max nb of predicted sites per peak: 36
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 6.67

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=65.31; evalue=4.9e-66

GaGAGAGAGARaGaraGrg

CYCTYTCTYTCTCTCTCTC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1332 (17.19%)
Max nb of predicted sites per peak: 21
(GWHCAYC00000006:16505419-16505520(-))
Mean nb of predicted sites per peak: 3.96

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=300; evalue=1e-300

tataTaTATATAwatawatatata

TATATATWTATWTATATATATATA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 517 (6.67%)
Max nb of predicted sites per peak: 34
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 5.73

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=300; evalue=1e-300

twtatatwTaTwTATATawawata

TATWTWTATATAWATAWATATAWA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 545 (7.03%)
Max nb of predicted sites per peak: 35
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 5.74

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=72.10; evalue=7.9e-73

ataTwTATwTATAtATAtaTwtat

ATAWATATATATATAWATAWATAT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 320 (4.13%)
Max nb of predicted sites per peak: 33
(GWHCAYC00000005:740047-740148(-))
Mean nb of predicted sites per peak: 7.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: Broad_promoter (02/01/2025 09:44)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results