peak-motifs p53

motif discovery

oligos_6nt_mkv2

oligos_6nt_mkv2_m1	assembly: ggacatgcccagcct (sig=31.72; e-value=1.9e-32)	RC: aggctgggcatgtcc
oligos_6nt_mkv2_m2	assembly: ggacatgtcc (sig=25.68; e-value=2.1e-26)	RC: ggacatgtcc
oligos_6nt_mkv2_m3	assembly: ggacatgcccaggcatgtcc (sig=31.72; e-value=1.9e-32)	RC: ggacatgcctgggcatgtcc
oligos_6nt_mkv2_m4	assembly: aggctgggcatgcccagcct (sig=31.72; e-value=1.9e-32)	RC: aggctgggcatgcccagcct
oligos_6nt_mkv2_m5	assembly: aacatgcccagcct (sig=31.72; e-value=1.9e-32)	RC: aggctgggcatgtt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: catgcc (sig=3.30; e-value=0.0005)	RC: ggcatg
positions_6nt_m2	assembly: catgtc (sig=1.85; e-value=0.014)	RC: gacatg
positions_6nt_m3	: (sig=; e-value=1)	RC:
positions_6nt_m4	: (sig=; e-value=1)	RC:
positions_6nt_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv2

oligos_7nt_mkv2_m1	assembly: ggacatgcccaggcatgtcc (sig=46.67; e-value=2.1e-47)	RC: ggacatgcctgggcatgtcc
oligos_7nt_mkv2_m2	assembly: agacatgcccaggcatgtcc (sig=46.67; e-value=2.1e-47)	RC: ggacatgcctgggcatgtct
oligos_7nt_mkv2_m3	assembly: ggacatgtcc (sig=17.72; e-value=1.9e-18)	RC: ggacatgtcc
oligos_7nt_mkv2_m4	assembly: gggcatgcccaggcatgtcc (sig=46.67; e-value=2.1e-47)	RC: ggacatgcctgggcatgccc
oligos_7nt_mkv2_m5	assembly: gacatgcctgggcatgtctg (sig=46.67; e-value=2.1e-47)	RC: cagacatgcccaggcatgtc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

Not a single significant pattern

[positions_7nt]

Motif discovery

Motif 1 oligos_6nt_mkv2_m1

k-mer sig=31.72; evalue=1.9e-32

csrGACATGCCCrGrCawG

CWTGYCYGGGCATGTCYSG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 125 (73.96%)
Max nb of predicted sites per peak: 9
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 2.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv2_m2

k-mer sig=25.68; evalue=2.1e-26

cyrGrCATGyCyrg

CYRGRCATGYCYRG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 103 (60.95%)
Max nb of predicted sites per peak: 18
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 2.81

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv2_m3

k-mer sig=31.72; evalue=1.9e-32

sbrGrCATGYCYrGrCATGyCyvs

SBRGRCATGYCYRGRCATGYCYVS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 116 (68.64%)
Max nb of predicted sites per peak: 6
(chr8:8220396-8220690)
Mean nb of predicted sites per peak: 2.53

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv2_m4

k-mer sig=31.72; evalue=1.9e-32

CwtgyCtGGRCATGYCCaGrCawg

CWTGYCTGGRCATGYCCAGRCAWG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 101 (59.76%)
Max nb of predicted sites per peak: 6
(chr8:8220396-8220690)
Mean nb of predicted sites per peak: 2.88

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv2_m5

k-mer sig=31.72; evalue=1.9e-32

srrACATGCCCaGrcawg

CWTGYCTGGGCATGTYYS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 125 (73.96%)
Max nb of predicted sites per peak: 9
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 2.13

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=3.30; evalue=0.0005

GrCATGCCyr

YRGGCATGYC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 106 (62.72%)
Max nb of predicted sites per peak: 9
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 1.89

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=1.85; evalue=0.014

GrCATGTCyg

CRGACATGYC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 103 (60.95%)
Max nb of predicted sites per peak: 18
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 2.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_mkv2_m1

k-mer sig=46.67; evalue=2.1e-47

ssgGrCaTGYCYrGRCATGyCyvr

YBRGRCATGYCYRGRCATGYCCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 114 (67.46%)
Max nb of predicted sites per peak: 6
(chr8:8220396-8220690)
Mean nb of predicted sites per peak: 2.53

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_mkv2_m2

k-mer sig=46.67; evalue=2.1e-47

bbrGrCATGCCYrGrCATGyCyvr

YBRGRCATGYCYRGGCATGYCYVV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 117 (69.23%)
Max nb of predicted sites per peak: 6
(chr8:8220396-8220690)
Mean nb of predicted sites per peak: 2.49

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_7nt_mkv2_m3

k-mer sig=17.72; evalue=1.9e-18

cyGGRCATGYCCrg

CYGGRCATGYCCRG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 96 (56.80%)
Max nb of predicted sites per peak: 18
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 2.82

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv2_m4

k-mer sig=46.67; evalue=2.1e-47

skgGrCaTGyCYrGRCATGyCyss

SSRGRCATGYCYRGRCATGYCCMS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 120 (71.01%)
Max nb of predicted sites per peak: 9
(chr1:10804449-10804679)
Mean nb of predicted sites per peak: 2.55

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv2_m5

k-mer sig=46.67; evalue=2.1e-47

brGrCATGyCyRGRCATGYCyssr

YSSRGRCATGYCYRGRCATGYCYV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 120 (71.01%)
Max nb of predicted sites per peak: 6
(chr8:8220396-8220690)
Mean nb of predicted sites per peak: 2.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: p53_peaks (04/01/2025 14:23)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results