peak-motifs RPS14_pr18812_vs

Motif discovery

Motif 1 oligos_6nt_test_vs_ctrl_m1

k-mer sig=0.70; evalue=0.2

CTACCTGCACGTCGTCTCCAGACT

AGTCTGGAGACGACGTGCAGGTAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

No match

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

No match

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_test_vs_ctrl_m2

k-mer sig=0.70; evalue=0.2

TGCACGTCGTCTCCAGACTCCACA

TGTGGAGTCTGGAGACGACGTGCA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

No match

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

No match

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_test_vs_ctrl_m3

k-mer sig=0.70; evalue=0.2

GAAAGAGAGAGT

ACTCTCTCTTTC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GAAAGAGAGAGT

PRDM1_known2 PRDM1_known2 D 12 0.8000 0.786 0.629 NA NA

IRF_known17 IRF_known17 D 12 0.8571 0.709 0.608 NA NA

BCL_disc4 BCL_disc4 D 10 0.8333 0.718 0.598 NA NA

Total matches= 4 (1 more)

[ match table: html text ]
[ alignments (logos): html text ]

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GAAAGAGAGAGT

homer_229_PRDM1 homer_229_PRDM1 R 12 1.0000 0.763 0.763 NA NA

homer_136_IRF1 homer_136_IRF1 D 12 1.0000 0.735 0.735 NA NA

homer_177_GAATGGAAAAAATGAGTCAT homer_177_GAATGGAAAAAATGAGTCAT D 12 0.6000 0.714 0.428 NA NA

Total matches= 3

[ match table: html text ]
[ alignments (logos): html text ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GAAAGAGAGAGT

IRF7 MA0772.2 D 12 0.9231 0.709 0.654 NA NA

Stat2 MA1623.2 D 10 0.8333 0.735 0.612 NA NA

PRDM1 MA0508.4 R 7 0.5833 0.814 0.475 NA NA

Total matches= 3

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_test_vs_ctrl_m5

k-mer sig=0.70; evalue=0.2

CCCACTCTCTCTT

AAGAGAGAGTGGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CCCACTCTCTCTT

PAX5_disc4 PAX5_disc4 D 10 0.7692 0.726 0.558 NA NA

PRDM1_known2 PRDM1_known2 R 12 0.7500 0.731 0.548 NA NA

CACBP_1 CACBP_1 R 9 0.6923 0.722 0.500 NA NA

Total matches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CCCACTCTCTCTT

homer_229_PRDM1 homer_229_PRDM1 D 10 0.6667 0.773 0.515 NA NA

homer_62_Egr1 homer_62_Egr1 R 8 0.5333 0.768 0.410 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CCCACTCTCTCTT

Spi1 MA0080.7 R 12 0.8571 0.709 0.608 NA NA

PRDM1 MA0508.4 D 7 0.5385 0.814 0.438 NA NA

NKX2-2 MA1645.2 D 8 0.6154 0.706 0.434 NA NA

Total matches= 4 (1 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_test_vs_ctrl_m6

k-mer sig=0.70; evalue=0.2

ymGwCTCCAsACyss

SSRGTSTGGAGWCKR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

CACD_2 CACD_2 D 8 0.5333 0.762 0.406 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

homer_258_Smad4 homer_258_Smad4 R 9 0.5625 0.773 0.435 NA NA

homer_256_Smad2 homer_256_Smad2 R 8 0.5333 0.794 0.423 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

Hand1 MA2123.1 D 9 0.6000 0.814 0.489 NA NA

ZBTB26 MA1579.2 D 8 0.5333 0.790 0.421 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 2
(hg38_dna)
Mean nb of predicted sites per peak: 2.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_6nt_test_vs_ctrl_m7

k-mer sig=0.70; evalue=0.2

GTCTGGAGACGACGTGCAGGTAGG

CCTACCTGCACGTCGTCTCCAGAC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

No match

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

No match

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_6nt_test_vs_ctrl_m8

k-mer sig=0.70; evalue=0.2 No logo

No logo

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ACCGGAAAGA

FLI1_3 FLI1_3 D 10 1.0000 0.775 0.775 NA NA

ETS_known16 ETS_known16 D 10 1.0000 0.774 0.774 NA NA

ETV2_1 ETV2_1 D 10 0.9091 0.849 0.772 NA NA

Total matches= 42 (39 more)

[ match table: html text ]
[ alignments (logos): html text ]

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ACCGGAAAGA

homer_69_Elk4 homer_69_Elk4 R 10 1.0000 0.752 0.752 NA NA

homer_68_Elk1 homer_68_Elk1 R 10 1.0000 0.735 0.735 NA NA

homer_85_Fli1 homer_85_Fli1 R 10 1.0000 0.709 0.709 NA NA

Total matches= 6 (3 more)

[ match table: html text ]
[ alignments (logos): html text ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ACCGGAAAGA

ETV2 MA0762.2 D 9 0.9000 0.865 0.779 NA NA

FLI1 MA0475.3 D 9 0.9000 0.821 0.739 NA NA

ETS1 MA0098.4 D 9 0.9000 0.798 0.718 NA NA

Total matches= 32 (29 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_test_vs_ctrl_m1

k-mer sig=1.26; evalue=0.055

CTCCAGACTCCACACCGGAAAGAG

CTCTTTCCGGTGTGGAGTCTGGAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

No match

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

No match

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_test_vs_ctrl_m3

k-mer sig=1.26; evalue=0.055

GGAGTCTGGAGACGACGTGCAGGT

ACCTGCACGTCGTCTCCAGACTCC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

No match

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

No match

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_7nt_test_vs_ctrl_m4

k-mer sig=1.26; evalue=0.055 No logo

No logo

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

PRDM1_known2 PRDM1_known2 R 15 0.8333 0.718 0.598 NA NA

PAX5_disc4 PAX5_disc4 D 10 0.5556 0.726 0.403 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

homer_229_PRDM1 homer_229_PRDM1 D 12 0.6667 0.763 0.509 NA NA

homer_136_IRF1 homer_136_IRF1 R 12 0.6667 0.735 0.490 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

Spi1 MA0080.7 R 13 0.7222 0.720 0.520 NA NA

Stat2 MA1623.2 R 10 0.5556 0.735 0.408 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(hg38_dna)
Mean nb of predicted sites per peak: 1.00

[ view in genome browser :

]
[ sites: text BED (UCSC track) ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus ENCODE database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]
Motifs versus Homer database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]
Motifs versus JASPAR2024_CORE_vertebrates_non-redundant database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: RPS14_pr18812_vs_pr18813 (28/01/2025 13:34)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CCCACTCTCTCTT

homer_229_PRDM1 homer_229_PRDM1 D 10 0.6667 0.773 0.515 NA NA

homer_62_Egr1 homer_62_Egr1 R 8 0.5333 0.768 0.410 NA NA

Total matches= 2

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

CACD_2 CACD_2 D 8 0.5333 0.762 0.406 NA NA

Total matches= 1

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

homer_258_Smad4 homer_258_Smad4 R 9 0.5625 0.773 0.435 NA NA

homer_256_Smad2 homer_256_Smad2 R 8 0.5333 0.794 0.423 NA NA

Total matches= 2

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

Hand1 MA2123.1 D 9 0.6000 0.814 0.489 NA NA

ZBTB26 MA1579.2 D 8 0.5333 0.790 0.421 NA NA

Total matches= 2

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

PRDM1_known2 PRDM1_known2 R 15 0.8333 0.718 0.598 NA NA

PAX5_disc4 PAX5_disc4 D 10 0.5556 0.726 0.403 NA NA

Total matches= 2

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

homer_229_PRDM1 homer_229_PRDM1 D 12 0.6667 0.763 0.509 NA NA

homer_136_IRF1 homer_136_IRF1 R 12 0.6667 0.735 0.490 NA NA

Total matches= 2

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

Spi1 MA0080.7 R 13 0.7222 0.720 0.520 NA NA

Stat2 MA1623.2 R 10 0.5556 0.735 0.408 NA NA

Total matches= 2

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: RPS14_pr18812_vs_pr18813 (28/01/2025 13:34)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT Total matches= 0

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT Total matches= 0

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA Total matches= 0

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA Total matches= 0

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CCCACTCTCTCTT homer_229_PRDM1 homer_229_PRDM1 D 10 0.6667 0.773 0.515 NA NA homer_62_Egr1 homer_62_Egr1 R 8 0.5333 0.768 0.410 NA NA Total matches= 2

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ymGwCTCCAsACyss CACD_2 CACD_2 D 8 0.5333 0.762 0.406 NA NA Total matches= 1

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ymGwCTCCAsACyss homer_258_Smad4 homer_258_Smad4 R 9 0.5625 0.773 0.435 NA NA homer_256_Smad2 homer_256_Smad2 R 8 0.5333 0.794 0.423 NA NA Total matches= 2

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ymGwCTCCAsACyss Hand1 MA2123.1 D 9 0.6000 0.814 0.489 NA NA ZBTB26 MA1579.2 D 8 0.5333 0.790 0.421 NA NA Total matches= 2

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG Total matches= 0

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG Total matches= 0

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG Total matches= 0

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG Total matches= 0

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT Total matches= 0

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT Total matches= 0

ENCODE name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TCCCACTCTCTCTTTCCG PRDM1_known2 PRDM1_known2 R 15 0.8333 0.718 0.598 NA NA PAX5_disc4 PAX5_disc4 D 10 0.5556 0.726 0.403 NA NA Total matches= 2

Homer name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TCCCACTCTCTCTTTCCG homer_229_PRDM1 homer_229_PRDM1 D 12 0.6667 0.763 0.509 NA NA homer_136_IRF1 homer_136_IRF1 R 12 0.6667 0.735 0.490 NA NA Total matches= 2

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TCCCACTCTCTCTTTCCG Spi1 MA0080.7 R 13 0.7222 0.720 0.520 NA NA Stat2 MA1623.2 R 10 0.5556 0.735 0.408 NA NA Total matches= 2

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTACCTGCACGTCGTCTCCAGACT

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TGCACGTCGTCTCCAGACTCCACA

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CCCACTCTCTCTT

homer_229_PRDM1 homer_229_PRDM1 D 10 0.6667 0.773 0.515 NA NA

homer_62_Egr1 homer_62_Egr1 R 8 0.5333 0.768 0.410 NA NA

Total matches= 2

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

CACD_2 CACD_2 D 8 0.5333 0.762 0.406 NA NA

Total matches= 1

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

homer_258_Smad4 homer_258_Smad4 R 9 0.5625 0.773 0.435 NA NA

homer_256_Smad2 homer_256_Smad2 R 8 0.5333 0.794 0.423 NA NA

Total matches= 2

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymGwCTCCAsACyss

Hand1 MA2123.1 D 9 0.6000 0.814 0.489 NA NA

ZBTB26 MA1579.2 D 8 0.5333 0.790 0.421 NA NA

Total matches= 2

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GTCTGGAGACGACGTGCAGGTAGG

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CTCCAGACTCCACACCGGAAAGAG

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGAGTCTGGAGACGACGTGCAGGT

Total matches= 0

ENCODE

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

PRDM1_known2 PRDM1_known2 R 15 0.8333 0.718 0.598 NA NA

PAX5_disc4 PAX5_disc4 D 10 0.5556 0.726 0.403 NA NA

Total matches= 2

Homer

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

homer_229_PRDM1 homer_229_PRDM1 D 12 0.6667 0.763 0.509 NA NA

homer_136_IRF1 homer_136_IRF1 R 12 0.6667 0.735 0.490 NA NA

Total matches= 2

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TCCCACTCTCTCTTTCCG

Spi1 MA0080.7 R 13 0.7222 0.720 0.520 NA NA

Stat2 MA1623.2 R 10 0.5556 0.735 0.408 NA NA

Total matches= 2