peak-motifs diffupx

motif discovery

oligos_6nt_mkv3

oligos_6nt_mkv3_m1	assembly: gctgtcaaa (sig=47.91; e-value=1.2e-48)	RC: tttgacagc
oligos_6nt_mkv3_m2	assembly: gcacgcacgg (sig=26.94; e-value=1.1e-27)	RC: ccgtgcgtgc
oligos_6nt_mkv3_m3	assembly: cacatacac (sig=18.30; e-value=5e-19)	RC: gtgtatgtg
oligos_6nt_mkv3_m4	assembly: acaaacaaa (sig=16.82; e-value=1.5e-17)	RC: tttgtttgt
oligos_6nt_mkv3_m5	assembly: ggcgagcgag (sig=15.58; e-value=2.6e-16)	RC: ctcgctcgcc
oligos_6nt_mkv3_m6	assembly: cccaccc (sig=11.28; e-value=5.2e-12)	RC: gggtggg
oligos_6nt_mkv3_m7	assembly: cactcactt (sig=10.02; e-value=9.5e-11)	RC: aagtgagtg
oligos_6nt_mkv3_m8	assembly: caacaaacaac (sig=16.82; e-value=1.5e-17)	RC: gttgtttgttg
oligos_6nt_mkv3_m9	assembly: cgaacga (sig=8.06; e-value=8.7e-09)	RC: tcgttcg
oligos_6nt_mkv3_m10	assembly: cttacct (sig=7.01; e-value=9.8e-08)	RC: aggtaag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: ctgtcaa (sig=0.56; e-value=0.28)	RC: ttgacag
positions_6nt_m2	: (sig=; e-value=1)	RC:
positions_6nt_m3	: (sig=; e-value=1)	RC:
positions_6nt_m4	: (sig=; e-value=1)	RC:
positions_6nt_m5	: (sig=; e-value=1)	RC:
positions_6nt_m6	: (sig=; e-value=1)	RC:
positions_6nt_m7	: (sig=; e-value=1)	RC:
positions_6nt_m8	: (sig=; e-value=1)	RC:
positions_6nt_m9	: (sig=; e-value=1)	RC:
positions_6nt_m10	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv4

oligos_7nt_mkv4_m1	assembly: cacatacac (sig=9.92; e-value=1.2e-10)	RC: gtgtatgtg
oligos_7nt_mkv4_m2	assembly: agctgtcaaa (sig=7.90; e-value=1.3e-08)	RC: tttgacagct
oligos_7nt_mkv4_m3	assembly: acacgcaca (sig=6.60; e-value=2.5e-07)	RC: tgtgcgtgt
oligos_7nt_mkv4_m4	assembly: ctctttct (sig=5.59; e-value=2.6e-06)	RC: agaaagag
oligos_7nt_mkv4_m5	assembly: ctcgctc (sig=2.49; e-value=0.0032)	RC: gagcgag
oligos_7nt_mkv4_m6	assembly: caccttgg (sig=2.11; e-value=0.0078)	RC: ccaaggtg
oligos_7nt_mkv4_m7	assembly: aatgtaa (sig=2.04; e-value=0.0091)	RC: ttacatt
oligos_7nt_mkv4_m8	assembly: aggtgta (sig=1.21; e-value=0.062)	RC: tacacct
oligos_7nt_mkv4_m9	assembly: cagacac (sig=1.07; e-value=0.085)	RC: gtgtctg
oligos_7nt_mkv4_m10	assembly: tgtaaaca (sig=1.05; e-value=0.089)	RC: tgtttaca

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: tgtcaaa (sig=2.22; e-value=0.006)	RC: tttgaca
positions_7nt_m2	: (sig=; e-value=1)	RC:
positions_7nt_m3	: (sig=; e-value=1)	RC:
positions_7nt_m4	: (sig=; e-value=1)	RC:
positions_7nt_m5	: (sig=; e-value=1)	RC:
positions_7nt_m6	: (sig=; e-value=1)	RC:
positions_7nt_m7	: (sig=; e-value=1)	RC:
positions_7nt_m8	: (sig=; e-value=1)	RC:
positions_7nt_m9	: (sig=; e-value=1)	RC:
positions_7nt_m10	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_8nt_mkv5

oligos_8nt_mkv5_m1	assembly: agagaaagaga (sig=5.45; e-value=3.5e-06)	RC: tctctttctct
oligos_8nt_mkv5_m2	assembly: cacacgcacac (sig=3.55; e-value=0.00028)	RC: gtgtgcgtgtg
oligos_8nt_mkv5_m3	assembly: aacaaaaa (sig=3.29; e-value=0.00051)	RC: tttttgtt
oligos_8nt_mkv5_m4	assembly: acacaaacac (sig=2.98; e-value=0.001)	RC: gtgtttgtgt
oligos_8nt_mkv5_m5	assembly: acacatacaca (sig=2.30; e-value=0.005)	RC: tgtgtatgtgt
oligos_8nt_mkv5_m6	assembly: cagacaca (sig=0.97; e-value=0.11)	RC: tgtgtctg
oligos_8nt_mkv5_m7	assembly: cacactca (sig=0.50; e-value=0.32)	RC: tgagtgtg
oligos_8nt_mkv5_m8	assembly: aacacaac (sig=0.43; e-value=0.37)	RC: gttgtgtt
oligos_8nt_mkv5_m9	assembly: agctgtca (sig=0.35; e-value=0.45)	RC: tgacagct
oligos_8nt_mkv5_m10	assembly: aaggtgta (sig=0.14; e-value=0.72)	RC: tacacctt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_8nt

Not a single significant pattern

[positions_8nt]

dyads

dyads_m1	assembly: cacgcacacacacacacacg (sig=229.55; e-value=2.8e-230)	RC: cgtgtgtgtgtgtgtgcgtg
dyads_m2	assembly: ctctctctctctctctc (sig=86.32; e-value=4.8e-87)	RC: gagagagagagagagag
dyads_m3	assembly: gctgtca (sig=51.28; e-value=5.2e-52)	RC: tgacagc
dyads_m4	assembly: atacacacacacacacgc (sig=229.55; e-value=2.8e-230)	RC: gcgtgtgtgtgtgtgtat
dyads_m5	assembly: aagagagagagcgagag (sig=86.32; e-value=4.8e-87)	RC: ctctcgctctctctctt
dyads_m6	assembly: cagcagc (sig=34.27; e-value=5.4e-35)	RC: gctgctg
dyads_m7	assembly: agtgtgtgtgtgtgcgtgtg (sig=229.55; e-value=2.8e-230)	RC: cacacgcacacacacacact
dyads_m8	assembly: caaaacaaacacacacacac (sig=229.55; e-value=2.8e-230)	RC: gtgtgtgtgtgtttgttttg
dyads_m9	assembly: gcacacacacacacgcacgc (sig=229.55; e-value=2.8e-230)	RC: gcgtgcgtgtgtgtgtgtgc
dyads_m10	assembly: taaagaaaaac (sig=31.52; e-value=3e-32)	RC: gtttttcttta

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv3_m1

k-mer sig=47.91; evalue=1.2e-48

saGCTGTCAaavg

CBTTTGACAGCTS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 106 (25.36%)
Max nb of predicted sites per peak: 4
(X:7272258-7272657)
Mean nb of predicted sites per peak: 1.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv3_m2

k-mer sig=26.94; evalue=1.1e-27

acgCACGCACGsrc

GYSCGTGCGTGCGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 203 (48.56%)
Max nb of predicted sites per peak: 77
(X:5016467-5016866)
Mean nb of predicted sites per peak: 4.67

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv3_m3

k-mer sig=18.30; evalue=5e-19

CACACAYACACAC

GTGTGTRTGTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 234 (55.98%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 8.98

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv3_m4

k-mer sig=16.82; evalue=1.5e-17

amacAAACAAAma

TKTTTGTTTGTKT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 125 (29.90%)
Max nb of predicted sites per peak: 4
(X:989195-989594)
Mean nb of predicted sites per peak: 1.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv3_m5

k-mer sig=15.58; evalue=2.6e-16

agaGmGAGmGAGag

CTCTCKCTCKCTCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 156 (37.32%)
Max nb of predicted sites per peak: 41
(X:5459525-5459924)
Mean nb of predicted sites per peak: 6.37

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_6nt_mkv3_m6

k-mer sig=11.28; evalue=5.2e-12

cyCCCACCCcc

GGGGGTGGGRG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 85 (20.33%)
Max nb of predicted sites per peak: 11
(X:955171-955570)
Mean nb of predicted sites per peak: 2.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_6nt_mkv3_m7

k-mer sig=10.02; evalue=9.5e-11

cwCACTCwCTywc

GWRAGWGAGTGWG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 147 (35.17%)
Max nb of predicted sites per peak: 25
(X:15814338-15814737)
Mean nb of predicted sites per peak: 4.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_6nt_mkv3_m8

k-mer sig=16.82; evalue=1.5e-17

aaCAACAAACAACmm

KKGTTGTTTGTTGTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 81 (19.38%)
Max nb of predicted sites per peak: 3
(X:9897392-9897791)
Mean nb of predicted sites per peak: 1.23

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_6nt_mkv3_m9

k-mer sig=8.06; evalue=8.7e-09

mgCGAACGAgm

KCTCGTTCGCK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 82 (19.62%)
Max nb of predicted sites per peak: 4
(X:9434645-9435044)
Mean nb of predicted sites per peak: 1.24

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_6nt_mkv3_m10

k-mer sig=7.01; evalue=9.8e-08

ycCTTACCTyy

RRAGGTAAGGR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 51 (12.20%)
Max nb of predicted sites per peak: 2
(X:7303479-7303878)
Mean nb of predicted sites per peak: 1.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 positions_6nt_m1

k-mer sig=0.56; evalue=0.28

agCTGTCAAwm

KWTTGACAGCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 94 (22.49%)
Max nb of predicted sites per peak: 3
(X:9803839-9804238)
Mean nb of predicted sites per peak: 1.32

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv4_m1

k-mer sig=9.92; evalue=1.2e-10

CACACACACACAC

GTGTGTGTGTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 232 (55.50%)
Max nb of predicted sites per peak: 80
(X:5016467-5016866)
Mean nb of predicted sites per peak: 8.49

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv4_m2

k-mer sig=7.90; evalue=1.3e-08

vsaGCTGTCAAAmr

YKTTTGACAGCTSB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 91 (21.77%)
Max nb of predicted sites per peak: 4
(X:12548502-12548901)
Mean nb of predicted sites per peak: 1.26

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv4_m3

k-mer sig=6.60; evalue=2.5e-07

ACACACACACACA

TGTGTGTGTGTGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 229 (54.78%)
Max nb of predicted sites per peak: 80
(X:5016467-5016866)
Mean nb of predicted sites per peak: 8.26

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv4_m4

k-mer sig=5.59; evalue=2.6e-06

cTCTCTyTCTct

AGAGARAGAGAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 129 (30.86%)
Max nb of predicted sites per peak: 41
(X:5459525-5459924)
Mean nb of predicted sites per peak: 6.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 oligos_7nt_mkv4_m5

k-mer sig=2.49; evalue=0.0032

ctCTCkCTCtc

GAGAGMGAGAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 151 (36.12%)
Max nb of predicted sites per peak: 30
(X:7348929-7349328)
Mean nb of predicted sites per peak: 5.25

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 oligos_7nt_mkv4_m6

k-mer sig=2.11; evalue=0.0078

yaCACCTTGGyc

GRCCAAGGTGTR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 49 (11.72%)
Max nb of predicted sites per peak: 2
(X:23498641-23499040)
Mean nb of predicted sites per peak: 1.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 oligos_7nt_mkv4_m7

k-mer sig=2.04; evalue=0.0091

drAATGTAAww

WWTTACATTYH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 46 (11.00%)
Max nb of predicted sites per peak: 4
(X:8429226-8429625)
Mean nb of predicted sites per peak: 1.20

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 oligos_7nt_mkv4_m8

k-mer sig=1.21; evalue=0.062

srAGGTGTAyr

YRTACACCTYS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 42 (10.05%)
Max nb of predicted sites per peak: 3
(X:15733236-15733635)
Mean nb of predicted sites per peak: 1.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 oligos_7nt_mkv4_m9

k-mer sig=1.07; evalue=0.085

caCAGACACrc

GYGTGTCTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 122 (29.19%)
Max nb of predicted sites per peak: 5
(X:1473942-1474341)
Mean nb of predicted sites per peak: 1.39

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 21 oligos_7nt_mkv4_m10

k-mer sig=1.05; evalue=0.089

aaTGTAAACAma

TKTGTTTACATT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 65 (15.55%)
Max nb of predicted sites per peak: 3
(X:5889826-5890225)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 22 positions_7nt_m1

k-mer sig=2.22; evalue=0.006

rmTGTCAAAhw

WDTTTGACAKY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 82 (19.62%)
Max nb of predicted sites per peak: 3
(X:8439448-8439847)
Mean nb of predicted sites per peak: 1.17

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 23 oligos_8nt_mkv5_m1

k-mer sig=5.45; evalue=3.5e-06

aGAGAGArAGAGAgA

TCTCTCTYTCTCTCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 141 (33.73%)
Max nb of predicted sites per peak: 51
(X:5459525-5459924)
Mean nb of predicted sites per peak: 7.60

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 24 oligos_8nt_mkv5_m2

k-mer sig=3.55; evalue=0.00028

cACACACRCACACAC

GTGTGTGYGTGTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 239 (57.18%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 9.57

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 25 oligos_8nt_mkv5_m3

k-mer sig=3.29; evalue=0.00051

aaAACAAAAAma

TKTTTTTGTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 163 (39.00%)
Max nb of predicted sites per peak: 16
(X:14239911-14240310)
Mean nb of predicted sites per peak: 2.31

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 26 oligos_8nt_mkv5_m4

k-mer sig=2.98; evalue=0.001

ACACACACACACAC

GTGTGTGTGTGTGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 224 (53.59%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 9.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 27 oligos_8nt_mkv5_m5

k-mer sig=2.30; evalue=0.005

ACACACACACACACA

TGTGTGTGTGTGTGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 228 (54.55%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 9.87

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 28 oligos_8nt_mkv5_m6

k-mer sig=0.97; evalue=0.11

CACACACACACA

TGTGTGTGTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 221 (52.87%)
Max nb of predicted sites per peak: 80
(X:5016467-5016866)
Mean nb of predicted sites per peak: 7.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 29 oligos_8nt_mkv5_m7

k-mer sig=0.50; evalue=0.32

CACACACACACA

TGTGTGTGTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 229 (54.78%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 7.67

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 30 oligos_8nt_mkv5_m8

k-mer sig=0.43; evalue=0.37

mmAACACAACmm

KKGTTGTGTTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 46 (11.00%)
Max nb of predicted sites per peak: 2
(X:1030114-1030513)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 31 oligos_8nt_mkv5_m9

k-mer sig=0.35; evalue=0.45

vsAGCTGTCArm

KYTGACAGCTSB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 104 (24.88%)
Max nb of predicted sites per peak: 4
(X:12548502-12548901)
Mean nb of predicted sites per peak: 1.35

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 32 oligos_8nt_mkv5_m10

k-mer sig=0.14; evalue=0.72

vmAAGGTGTAtr

YATACACCTTKB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 51 (12.20%)
Max nb of predicted sites per peak: 4
(X:15733236-15733635)
Mean nb of predicted sites per peak: 1.25

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 33 dyads_m1

k-mer sig=229.55; evalue=2.8e-230

caCACACACACACACACACACaca

TGTGTGTGTGTGTGTGTGTGTGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 224 (53.59%)
Max nb of predicted sites per peak: 80
(X:5016467-5016866)
Mean nb of predicted sites per peak: 12.69

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 34 dyads_m2

k-mer sig=86.32; evalue=4.8e-87

ctCTCTCTCTCTCTCTCTCtc

GAGAGAGAGAGAGAGAGAGAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 127 (30.38%)
Max nb of predicted sites per peak: 59
(X:5459525-5459924)
Mean nb of predicted sites per peak: 10.48

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 35 dyads_m3

k-mer sig=51.28; evalue=5.2e-52

cmGCTGTCArh

DYTGACAGCKG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 94 (22.49%)
Max nb of predicted sites per peak: 3
(X:7272258-7272657)
Mean nb of predicted sites per peak: 1.30

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 36 dyads_m4

k-mer sig=229.55; evalue=2.8e-230

acACACACACACACACACaCac

GTGTGTGTGTGTGTGTGTGTGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 226 (54.07%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 12.27

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 37 dyads_m5

k-mer sig=86.32; evalue=4.8e-87

GagAGAGAGAGAGAGAGAGAg

CTCTCTCTCTCTCTCTCTCTC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 129 (30.86%)
Max nb of predicted sites per peak: 57
(X:5459525-5459924)
Mean nb of predicted sites per peak: 9.78

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 38 dyads_m6

k-mer sig=34.27; evalue=5.4e-35

agCAGCAGCag

CTGCTGCTGCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 81 (19.38%)
Max nb of predicted sites per peak: 7
(X:4571964-4572363)
Mean nb of predicted sites per peak: 1.86

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 39 dyads_m7

k-mer sig=229.55; evalue=2.8e-230

tGtGTGTGTGTGTGTGTGTGTGtg

CACACACACACACACACACACACA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 223 (53.35%)
Max nb of predicted sites per peak: 80
(X:5016467-5016866)
Mean nb of predicted sites per peak: 12.83

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 40 dyads_m8

k-mer sig=229.55; evalue=2.8e-230

acacAcACACACACACACACACAC

GTGTGTGTGTGTGTGTGTGTGTGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 219 (52.39%)
Max nb of predicted sites per peak: 80
(X:5016467-5016866)
Mean nb of predicted sites per peak: 12.38

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 41 dyads_m9

k-mer sig=229.55; evalue=2.8e-230

acaCACACACACACACACACaCac

GTGTGTGTGTGTGTGTGTGTGTGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 224 (53.59%)
Max nb of predicted sites per peak: 81
(X:5016467-5016866)
Mean nb of predicted sites per peak: 12.39

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 42 dyads_m10

k-mer sig=31.52; evalue=3e-32

rrwAAArAAAAACam

KTGTTTTTYTTTWYY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 170 (40.67%)
Max nb of predicted sites per peak: 15
(X:14239911-14240310)
Mean nb of predicted sites per peak: 2.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: diffupx_20h (24/04/2025 21:38)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results