peak-motifs rsat-4h-diffupall

motif discovery

oligos_6nt_mkv2

oligos_6nt_mkv2_m1	assembly: ggacgactccggagtcgtcc (sig=115.57; e-value=2.7e-116)	RC: ggacgactccggagtcgtcc
oligos_6nt_mkv2_m2	assembly: gtaggttccagagtcgtccg (sig=109.35; e-value=4.5e-110)	RC: cggacgactctggaacctac
oligos_6nt_mkv2_m3	assembly: acgattccg (sig=28.16; e-value=6.9e-29)	RC: cggaatcgt
oligos_6nt_mkv2_m4	assembly: cggacgactccgaacgac (sig=115.57; e-value=2.7e-116)	RC: gtcgttcggagtcgtccg
oligos_6nt_mkv2_m5	assembly: tctgaacccataccg (sig=21.14; e-value=7.2e-22)	RC: cggtatgggttcaga

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: gactcc (sig=1.34; e-value=0.046)	RC: ggagtc
positions_6nt_m2	: (sig=; e-value=1)	RC:
positions_6nt_m3	: (sig=; e-value=1)	RC:
positions_6nt_m4	: (sig=; e-value=1)	RC:
positions_6nt_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv2

oligos_7nt_mkv2_m1	assembly: ggacgactccggagtcgtcc (sig=138.70; e-value=2e-139)	RC: ggacgactccggagtcgtcc
oligos_7nt_mkv2_m2	assembly: gacgattccgg (sig=44.85; e-value=1.4e-45)	RC: ccggaatcgtc
oligos_7nt_mkv2_m3	assembly: caactccggacgactccgaa (sig=138.70; e-value=2e-139)	RC: ttcggagtcgtccggagttg
oligos_7nt_mkv2_m4	assembly: aacgactccggagtcgtccg (sig=138.70; e-value=2e-139)	RC: cggacgactccggagtcgtt
oligos_7nt_mkv2_m5	assembly: acgactccagagtcgtccgg (sig=138.70; e-value=2e-139)	RC: ccggacgactctggagtcgt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

Not a single significant pattern

[positions_7nt]

Motif discovery

Motif 1 oligos_6nt_mkv2_m1

k-mer sig=115.57; evalue=2.7e-116

YCGGAskmsTCCGGAskmsTCCGR

YCGGASKMSTCCGGASKMSTCCGR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 90 (53.25%)
Max nb of predicted sites per peak: 70
(UNKN:26330895-26331294)
Mean nb of predicted sites per peak: 32.53

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv2_m2

k-mer sig=109.35; evalue=4.5e-110

CGGAGTCrTCCRGAGTCGTCCGGA

TCCGGACGACTCYGGAYGACTCCG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 93 (55.03%)
Max nb of predicted sites per peak: 37
(UNKN:26330895-26331294)
Mean nb of predicted sites per peak: 19.54

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv2_m3

k-mer sig=28.16; evalue=6.9e-29

graCGAyTCCGra

TYCGGARTCGTYC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 107 (63.31%)
Max nb of predicted sites per peak: 38
(3L:22818939-22819338)
Mean nb of predicted sites per peak: 15.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv2_m4

k-mer sig=115.57; evalue=2.7e-116

TCCGGACGACTCCGrACGACTC

GAGTCGTYCGGAGTCGTCCGGA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 94 (55.62%)
Max nb of predicted sites per peak: 37
(UNKN:26330895-26331294)
Mean nb of predicted sites per peak: 20.95

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv2_m5

k-mer sig=21.14; evalue=7.2e-22

ATmmTGAACCCATACCGgt

ACCGGTATGGGTTCAKKAT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 22 (13.02%)
Max nb of predicted sites per peak: 12
(3L:19474033-19474432)
Mean nb of predicted sites per peak: 6.41

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=1.34; evalue=0.046

ACGACTCCGr

YCGGAGTCGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 96 (56.80%)
Max nb of predicted sites per peak: 36
(3L:22818939-22819338)
Mean nb of predicted sites per peak: 12.55

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_7nt_mkv2_m1

k-mer sig=138.70; evalue=2e-139

CCGGAskmsTCCGGAskmsTCCGR

YCGGASKMSTCCGGASKMSTCCGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 90 (53.25%)
Max nb of predicted sites per peak: 70
(UNKN:26330895-26331294)
Mean nb of predicted sites per peak: 32.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_mkv2_m2

k-mer sig=44.85; evalue=1.4e-45

CggACGACTCCGRAc

GTYCGGAGTCGTCCG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 103 (60.95%)
Max nb of predicted sites per peak: 39
(3L:22818939-22819338)
Mean nb of predicted sites per peak: 17.78

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_mkv2_m3

k-mer sig=138.70; evalue=2e-139

rACGACTCCGRACGACTCCGrAyG

CRTYCGGAGTCGTYCGGAGTCGTY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 94 (55.62%)
Max nb of predicted sites per peak: 36
(X:9507439-9507838)
Mean nb of predicted sites per peak: 20.84

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_7nt_mkv2_m4

k-mer sig=138.70; evalue=2e-139

CGrAsKMcTCCGGAskmsTCCGrA

TYCGGASKMSTCCGGAGKMSTYCG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 91 (53.85%)
Max nb of predicted sites per peak: 63
(3L:22782404-22782803)
Mean nb of predicted sites per peak: 29.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv2_m5

k-mer sig=138.70; evalue=2e-139

GGAskmsTCCrGAskmsTCCGGAs

STCCGGASKMSTCYGGASKMSTCC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 92 (54.44%)
Max nb of predicted sites per peak: 63
(3L:22782404-22782803)
Mean nb of predicted sites per peak: 29.05

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: rsat-4h-diffupall (24/04/2025 22:32)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results