peak-motifs TnaA_WD

motif discovery

oligos_6nt_mkv2

oligos_6nt_mkv2_m1	assembly: cgatactatcgatagtatcg (sig=9.81; e-value=1.5e-10)	RC: cgatactatcgatagtatcg
oligos_6nt_mkv2_m2	assembly: aacatcgatagtatcga (sig=9.81; e-value=1.5e-10)	RC: tcgatactatcgatgtt
oligos_6nt_mkv2_m3	assembly: aaaata (sig=1.33; e-value=0.047)	RC: tatttt
oligos_6nt_mkv2_m4	: (sig=; e-value=1)	RC:
oligos_6nt_mkv2_m5	: (sig=; e-value=1)	RC:
oligos_6nt_mkv2_m6	: (sig=; e-value=1)	RC:
oligos_6nt_mkv2_m7	: (sig=; e-value=1)	RC:
oligos_6nt_mkv2_m8	: (sig=; e-value=1)	RC:
oligos_6nt_mkv2_m9	: (sig=; e-value=1)	RC:
oligos_6nt_mkv2_m10	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

local_words_6nt

Not a single significant pattern

[local_words_6nt]

positions_6nt

positions_6nt_m1	assembly: tcgatag (sig=1.97; e-value=0.011)	RC: ctatcga
positions_6nt_m2	: (sig=; e-value=1)	RC:
positions_6nt_m3	: (sig=; e-value=1)	RC:
positions_6nt_m4	: (sig=; e-value=1)	RC:
positions_6nt_m5	: (sig=; e-value=1)	RC:
positions_6nt_m6	: (sig=; e-value=1)	RC:
positions_6nt_m7	: (sig=; e-value=1)	RC:
positions_6nt_m8	: (sig=; e-value=1)	RC:
positions_6nt_m9	: (sig=; e-value=1)	RC:
positions_6nt_m10	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv2

oligos_7nt_mkv2_m1	assembly: cgatactatcgatagtatcg (sig=10.77; e-value=1.7e-11)	RC: cgatactatcgatagtatcg
oligos_7nt_mkv2_m2	assembly: aaacatcgatagtatcgatg (sig=10.77; e-value=1.7e-11)	RC: catcgatactatcgatgttt
oligos_7nt_mkv2_m3	assembly: aataaata (sig=1.15; e-value=0.071)	RC: tatttatt
oligos_7nt_mkv2_m4	assembly: aaaacatcgatagtatcgat (sig=10.77; e-value=1.7e-11)	RC: atcgatactatcgatgtttt
oligos_7nt_mkv2_m5	assembly: gcgatactatcgatagtatc (sig=10.77; e-value=1.7e-11)	RC: gatactatcgatagtatcgc
oligos_7nt_mkv2_m6	: (sig=; e-value=1)	RC:
oligos_7nt_mkv2_m7	: (sig=; e-value=1)	RC:
oligos_7nt_mkv2_m8	: (sig=; e-value=1)	RC:
oligos_7nt_mkv2_m9	: (sig=; e-value=1)	RC:
oligos_7nt_mkv2_m10	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

local_words_7nt

Not a single significant pattern

[local_words_7nt]

positions_7nt

Not a single significant pattern

[positions_7nt]

dyads

dyads_m1	assembly: cgatactatcgatagtatcg (sig=14.30; e-value=5e-15)	RC: cgatactatcgatagtatcg
dyads_m2	assembly: aacatcgatagtatcgatgt (sig=14.30; e-value=5e-15)	RC: acatcgatactatcgatgtt
dyads_m3	assembly: taaaata (sig=3.11; e-value=0.00078)	RC: tatttta
dyads_m4	assembly: actnnnnnnnnnnnnnngcg (sig=1.88; e-value=0.013)	RC: cgcnnnnnnnnnnnnnnagt
dyads_m5	assembly: acatcgg (sig=3.37; e-value=0.00043)	RC: ccgatgt
dyads_m6	assembly: cccannnccc (sig=0.60; e-value=0.25)	RC: gggnnntggg
dyads_m7	assembly: ccgatagtatcgatactatc (sig=14.30; e-value=5e-15)	RC: gatagtatcgatactatcgg
dyads_m8	assembly: gcagca (sig=0.32; e-value=0.48)	RC: tgctgc
dyads_m9	assembly: taannnnnnaaa (sig=0.22; e-value=0.6)	RC: tttnnnnnntta
dyads_m10	assembly: ctgcac (sig=0.22; e-value=0.6)	RC: gtgcag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv2_m1

k-mer sig=9.81; evalue=1.5e-10

kyCGmTACwATCGATwGTAkCGrm

KYCGMTACWATCGATWGTAKCGRM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13 (37.14%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_77::chr3R:29063656-29063911(.))
Mean nb of predicted sites per peak: 2.46

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv2_m2

k-mer sig=9.81; evalue=1.5e-10

saamyatCGATAsTATCGatm

KATCGATASTATCGATRKTTS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor saamyatCGATAsTATCGatm

Dref Dref D 10 0.4762 0.884 0.421 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 12 (34.29%)
Max nb of predicted sites per peak: 5
(TnaA-WD_peak_117::chrX:10744996-10745212(.))
Mean nb of predicted sites per peak: 2.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv2_m3

k-mer sig=1.33; evalue=0.047

rwAAAATAww

WWTATTTTWY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rwAAAATAww

hb hb D 8 0.7273 0.716 0.521 NA NA

Antp Antp D 6 0.6000 0.813 0.488 NA NA

ap ap D 6 0.6000 0.771 0.462 NA NA

Total matches= 6 (3 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 15 (42.86%)
Max nb of predicted sites per peak: 5
(TnaA-WD_peak_116::chrX:5737857-5738203(.))
Mean nb of predicted sites per peak: 1.87

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 positions_6nt_m1

k-mer sig=1.97; evalue=0.011

haTCGATAGyw

WRCTATCGATD

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor haTCGATAGyw

Dref Dref D 9 0.7500 0.914 0.685 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 19 (54.29%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_77::chr3R:29063656-29063911(.))
Mean nb of predicted sites per peak: 2.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_7nt_mkv2_m1

k-mer sig=10.77; evalue=1.7e-11

stCGmTACtATCGATagTAkCGas

STCGMTACTATCGATAGTAKCGAS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor stCGmTACtATCGATagTAkCGas

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13 (37.14%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_77::chr3R:29063656-29063911(.))
Mean nb of predicted sites per peak: 2.31

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_7nt_mkv2_m2

k-mer sig=10.77; evalue=1.7e-11

rvaamcrTCGATASTATCGAyrrw

WYYRTCGATASTATCGAYGKTTBY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rvaamcrTCGATASTATCGAyrrw

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 15 (42.86%)
Max nb of predicted sites per peak: 5
(TnaA-WD_peak_18::chr2L:16257528-16257751(.))
Mean nb of predicted sites per peak: 2.20

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_7nt_mkv2_m3

k-mer sig=1.15; evalue=0.071

thaATAAATAww

WWTATTTATTDA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor thaATAAATAww

br-Z4 br-Z4 R 8 0.6667 0.789 0.526 NA NA

zen zen D 6 0.5000 0.946 0.473 NA NA

gt gt D 7 0.5833 0.764 0.446 NA NA

Total matches= 6 (3 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 12 (34.29%)
Max nb of predicted sites per peak: 3
(TnaA-WD_peak_84::chr4:43674-43954(.))
Mean nb of predicted sites per peak: 1.33

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_mkv2_m4

k-mer sig=10.77; evalue=1.7e-11

yvsaamcatCGATAsTATCGAtag

CTATCGATASTATCGATGKTTSBR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yvsaamcatCGATAsTATCGAtag

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 14 (40.00%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_18::chr2L:16257528-16257751(.))
Mean nb of predicted sites per peak: 2.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_mkv2_m5

k-mer sig=10.77; evalue=1.7e-11

mcyCGmtACtATCGATastAtCsa

TSGATASTATCGATAGTAKCGRGK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mcyCGmtACtATCGATastAtCsa

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13 (37.14%)
Max nb of predicted sites per peak: 5
(TnaA-WD_peak_117::chrX:10744996-10745212(.))
Mean nb of predicted sites per peak: 2.23

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 dyads_m1

k-mer sig=14.30; evalue=5e-15

kyCGmTACwATCGATwGTAkCGrm

KYCGMTACWATCGATWGTAKCGRM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13 (37.14%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_77::chr3R:29063656-29063911(.))
Mean nb of predicted sites per peak: 2.46

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 dyads_m2

k-mer sig=14.30; evalue=5e-15

saamsrTCGATAsTATCGAtrgrt

AYCYATCGATASTATCGAYSKTTS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor saamsrTCGATAsTATCGAtrgrt

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 14 (40.00%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_117::chrX:10744996-10745212(.))
Mean nb of predicted sites per peak: 2.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 dyads_m3

k-mer sig=3.11; evalue=0.00078

wrwAAAATAhw

WDTATTTTWYW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wrwAAAATAhw

hb hb D 8 0.6667 0.735 0.490 NA NA

Antp Antp D 6 0.5455 0.822 0.448 NA NA

pan pan D 6 0.5455 0.773 0.422 NA NA

Total matches= 6 (3 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 16 (45.71%)
Max nb of predicted sites per peak: 5
(TnaA-WD_peak_116::chrX:5737857-5738203(.))
Mean nb of predicted sites per peak: 1.88

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 dyads_m4

k-mer sig=1.88; evalue=0.013

sgACTvbmssssmrmtysrGCGky

RMCGCYSRAKYKSSSSKVBAGTCS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor sgACTvbmssssmrmtysrGCGky

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 11 (31.43%)
Max nb of predicted sites per peak: 3
(TnaA-WD_peak_46::chr3L:10871817-10873573(.))
Mean nb of predicted sites per peak: 1.55

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 dyads_m5

k-mer sig=3.37; evalue=0.00043

aaACATCGrtk

MAYCGATGTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaACATCGrtk

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13 (37.14%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_77::chr3R:29063656-29063911(.))
Mean nb of predicted sites per peak: 2.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 dyads_m6

k-mer sig=0.60; evalue=0.25

hcCCCamcyCCCmv

BKGGGRGKTGGGGD

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hcCCCamcyCCCmv

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 8 (22.86%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_4::chr2L:6078941-6079245(.))
Mean nb of predicted sites per peak: 2.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 dyads_m7

k-mer sig=14.30; evalue=5e-15

wstCGATAsTATCGATastwkCgw

WCGMWASTATCGATASTATCGASW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wstCGATAsTATCGATastwkCgw

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 11 (31.43%)
Max nb of predicted sites per peak: 3
(TnaA-WD_peak_32::chr2R:15931900-15932129(.))
Mean nb of predicted sites per peak: 1.82

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 dyads_m8

k-mer sig=0.32; evalue=0.48

swGCAGCAgs

SCTGCTGCWS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor swGCAGCAgs

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 8 (22.86%)
Max nb of predicted sites per peak: 9
(TnaA-WD_peak_46::chr3L:10871817-10873573(.))
Mean nb of predicted sites per peak: 2.50

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 dyads_m9

k-mer sig=0.22; evalue=0.6

wwTAAwrmwymAAAaw

WTTTTKRWKYWTTAWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTAAwrmwymAAAaw

hb hb D 9 0.5625 0.848 0.477 NA NA

cad cad R 9 0.5625 0.732 0.412 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 12 (34.29%)
Max nb of predicted sites per peak: 3
(TnaA-WD_peak_116::chrX:5737857-5738203(.))
Mean nb of predicted sites per peak: 1.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 dyads_m10

k-mer sig=0.22; evalue=0.6

ksCTGCACay

RTGTGCAGSM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ksCTGCACay

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 11 (31.43%)
Max nb of predicted sites per peak: 4
(TnaA-WD_peak_46::chr3L:10871817-10873573(.))
Mean nb of predicted sites per peak: 1.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus DMMPMM_drosophila database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: TnaA_WD_PRE (28/04/2025 20:39)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor saamyatCGATAsTATCGatm

Dref Dref D 10 0.4762 0.884 0.421 NA NA

Total matches= 1

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rwAAAATAww

hb hb D 8 0.7273 0.716 0.521 NA NA

Antp Antp D 6 0.6000 0.813 0.488 NA NA

ap ap D 6 0.6000 0.771 0.462 NA NA

Total matches= 6 (3 more)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor haTCGATAGyw

Dref Dref D 9 0.7500 0.914 0.685 NA NA

Total matches= 1

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor stCGmTACtATCGATagTAkCGas

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rvaamcrTCGATASTATCGAyrrw

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor thaATAAATAww

br-Z4 br-Z4 R 8 0.6667 0.789 0.526 NA NA

zen zen D 6 0.5000 0.946 0.473 NA NA

gt gt D 7 0.5833 0.764 0.446 NA NA

Total matches= 6 (3 more)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yvsaamcatCGATAsTATCGAtag

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mcyCGmtACtATCGATastAtCsa

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor saamsrTCGATAsTATCGAtrgrt

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wrwAAAATAhw

hb hb D 8 0.6667 0.735 0.490 NA NA

Antp Antp D 6 0.5455 0.822 0.448 NA NA

pan pan D 6 0.5455 0.773 0.422 NA NA

Total matches= 6 (3 more)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor sgACTvbmssssmrmtysrGCGky

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaACATCGrtk

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hcCCCamcyCCCmv

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wstCGATAsTATCGATastwkCgw

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor swGCAGCAgs

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTAAwrmwymAAAaw

hb hb D 9 0.5625 0.848 0.477 NA NA

cad cad R 9 0.5625 0.732 0.412 NA NA

Total matches= 2

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ksCTGCACay

Total matches= 0

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: TnaA_WD_PRE (28/04/2025 20:39)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor saamyatCGATAsTATCGatm Dref Dref D 10 0.4762 0.884 0.421 NA NA Total matches= 1

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor rwAAAATAww hb hb D 8 0.7273 0.716 0.521 NA NA Antp Antp D 6 0.6000 0.813 0.488 NA NA ap ap D 6 0.6000 0.771 0.462 NA NA Total matches= 6 (3 more)

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor haTCGATAGyw Dref Dref D 9 0.7500 0.914 0.685 NA NA Total matches= 1

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor stCGmTACtATCGATagTAkCGas Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor rvaamcrTCGATASTATCGAyrrw Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor thaATAAATAww br-Z4 br-Z4 R 8 0.6667 0.789 0.526 NA NA zen zen D 6 0.5000 0.946 0.473 NA NA gt gt D 7 0.5833 0.764 0.446 NA NA Total matches= 6 (3 more)

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor yvsaamcatCGATAsTATCGAtag Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor mcyCGmtACtATCGATastAtCsa Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor saamsrTCGATAsTATCGAtrgrt Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor wrwAAAATAhw hb hb D 8 0.6667 0.735 0.490 NA NA Antp Antp D 6 0.5455 0.822 0.448 NA NA pan pan D 6 0.5455 0.773 0.422 NA NA Total matches= 6 (3 more)

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor sgACTvbmssssmrmtysrGCGky Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor aaACATCGrtk Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor hcCCCamcyCCCmv Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor wstCGATAsTATCGATastwkCgw Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor swGCAGCAgs Total matches= 0

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor wwTAAwrmwymAAAaw hb hb D 9 0.5625 0.848 0.477 NA NA cad cad R 9 0.5625 0.732 0.412 NA NA Total matches= 2

DMMPMM_drosophila name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ksCTGCACay Total matches= 0

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor saamyatCGATAsTATCGatm

Dref Dref D 10 0.4762 0.884 0.421 NA NA

Total matches= 1

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rwAAAATAww

hb hb D 8 0.7273 0.716 0.521 NA NA

Antp Antp D 6 0.6000 0.813 0.488 NA NA

ap ap D 6 0.6000 0.771 0.462 NA NA

Total matches= 6 (3 more)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor haTCGATAGyw

Dref Dref D 9 0.7500 0.914 0.685 NA NA

Total matches= 1

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor stCGmTACtATCGATagTAkCGas

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rvaamcrTCGATASTATCGAyrrw

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor thaATAAATAww

br-Z4 br-Z4 R 8 0.6667 0.789 0.526 NA NA

zen zen D 6 0.5000 0.946 0.473 NA NA

gt gt D 7 0.5833 0.764 0.446 NA NA

Total matches= 6 (3 more)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yvsaamcatCGATAsTATCGAtag

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mcyCGmtACtATCGATastAtCsa

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kyCGmTACwATCGATwGTAkCGrm

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor saamsrTCGATAsTATCGAtrgrt

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wrwAAAATAhw

hb hb D 8 0.6667 0.735 0.490 NA NA

Antp Antp D 6 0.5455 0.822 0.448 NA NA

pan pan D 6 0.5455 0.773 0.422 NA NA

Total matches= 6 (3 more)

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor sgACTvbmssssmrmtysrGCGky

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaACATCGrtk

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hcCCCamcyCCCmv

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wstCGATAsTATCGATastwkCgw

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor swGCAGCAgs

Total matches= 0

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTAAwrmwymAAAaw

hb hb D 9 0.5625 0.848 0.477 NA NA

cad cad R 9 0.5625 0.732 0.412 NA NA

Total matches= 2

DMMPMM_drosophila

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ksCTGCACay

Total matches= 0