RSAT - peak-motifs result

Analysis: ciao (23/06/2025 13:01)

Command

peak-motifs  -v 1 -title ciao -i $RSAT/public_html/tmp/www-data/2025/06/23/peak-motifs.2025-06-23.130112_2025-06-23.130112_48tvdX/peak-motifspeak_seq -max_seq_len 1000 -markov auto -disco oligos,positions -nmotifs 5 -minol 6 -maxol 7 -no_merge_lengths -2str -origin center -scan_markov 1 -task purge,seqlen,composition,disco,merge_motifs,split_motifs,motifs_vs_motifs,timelog,archive,synthesis,small_summary,scan -prefix peak-motifs -noov -img_format png -outdir $RSAT/public_html/tmp/www-data/2025/06/23/peak-motifs.2025-06-23.130112_2025-06-23.130112_48tvdX

Sequence composition

Sequence composition (test sequences)

Nb of peaks: 1
Total seq. size: 0 kb
Min length: 25 bp
Mean length: 25 bp
Max length: 25 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Discovered motifs (by algorithm)

motif discovery

oligos_6nt_mkv1

oligos_6nt_mkv1_m1	assembly: ctggaggtcgaacc (sig=1.09; e-value=0.081)	RC: ggttcgacctccag
oligos_6nt_mkv1_m2	assembly: cagcgca (sig=0.29; e-value=0.51)	RC: tgcgctg
oligos_6nt_mkv1_m3	: (sig=; e-value=1)	RC:
oligos_6nt_mkv1_m4	: (sig=; e-value=1)	RC:
oligos_6nt_mkv1_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

Not a single significant pattern

[positions_6nt]

oligos_7nt_mkv1

oligos_7nt_mkv1_m1	assembly: gctgccctggaggtcgaacc (sig=1.73; e-value=0.019)	RC: ggttcgacctccagggcagc
oligos_7nt_mkv1_m2	assembly: gacctccagggcagcgcagg (sig=1.52; e-value=0.03)	RC: cctgcgctgccctggaggtc
oligos_7nt_mkv1_m3	: (sig=; e-value=1)	RC:
oligos_7nt_mkv1_m4	: (sig=; e-value=1)	RC:
oligos_7nt_mkv1_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

Not a single significant pattern

[positions_7nt]

Discovered motifs (with motif comparison)

Motif discovery

Motif 1 oligos_6nt_mkv1_m2

k-mer sig=0.29; evalue=0.51 No logo

No logo

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 2
(seq1)
Mean nb of predicted sites per peak: 2.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_7nt_mkv1_m2

k-mer sig=1.52; evalue=0.03 No logo

No logo

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 2
(seq1)
Mean nb of predicted sites per peak: 2.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif locations (sites)

Predicted sites on test peaks (all motifs)

[tab]
[bed]

Motif comparisons

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Command:  peak-motifs  -v 1 -title ciao -i $RSAT/public_html/tmp/www-data/2025/06/23/peak-motifs.2025-06-23.130112_2025-06-23.130112_48tvdX/peak-motifspeak_seq -max_seq_len 1000 -markov auto -disco oligos,positions -nmotifs 5 -minol 6 -maxol 7 -no_merge_lengths -2str -origin center -scan_markov 1 -task purge,seqlen,composition,disco,merge_motifs,split_motifs,motifs_vs_motifs,timelog,archive,synthesis,small_summary,scan -prefix peak-motifs -noov -img_format png -outdir $RSAT/public_html/tmp/www-data/2025/06/23/peak-motifs.2025-06-23.130112_2025-06-23.130112_48tvdX

Logs and parameter files

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

Publications

Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J. (2012). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Res 40(4): e31.
Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012). A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets using peak-motifs. Nat Protoc 7(8): 1551-1568.

; Job started 2025_06_23.130114 ; Job done 2025_06_23.130114 ; Job started 2025_06_23.130114 ; Job done 2025_06_23.130114 ; Job started 2025_06_23.130118 ; Job done 2025_06_23.130118 ; Job started 2025_06_23.130120 ; Job done 2025_06_23.130120

Warning: Not a single pattern was found in file tmp/www-data/2025/06/23/peak-motifs.2025-06-23.130112_2025-06-23.130112_48tvdX/results/positions_6nt/peak-motifs_positions-2str-noov_6nt_ci50.tab

Warning: Not a single pattern was found in file tmp/www-data/2025/06/23/peak-motifs.2025-06-23.130112_2025-06-23.130112_48tvdX/results/positions_7nt/peak-motifs_positions-2str-noov_7nt_ci50.tab