peak-motifs myc

Sequence composition (test sequences)

Nb of peaks: 1
Total seq. size: 1 kb
Min length: 1000 bp
Mean length: 1000 bp
Max length: 1000 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Sequence composition (ctrl sequences)

Nb of peaks: 1
Total seq. size: 1 kb
Min length: 1000 bp
Mean length: 1000 bp
Max length: 1000 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Motif discovery

Motif 1 oligos_6nt_test_vs_ctrl_m1

k-mer sig=10.64; evalue=2.3e-11

yyyTCAyCACCAvrv

BYBTGGTGRTGARRR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 4
(ecDNA)
Mean nb of predicted sites per peak: 4.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_test_vs_ctrl_m2

k-mer sig=7.62; evalue=2.4e-08

hykAyAGTCrTb

VAYGACTRTMRD

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 3
(ecDNA)
Mean nb of predicted sites per peak: 3.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_test_vs_ctrl_m3

k-mer sig=10.64; evalue=2.3e-11

CCCTCACCACCAAAAGTAGGGCTA

TAGCCCTACTTTTGGTGGTGAGGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 1
(ecDNA)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_test_vs_ctrl_m4

k-mer sig=7.62; evalue=2.4e-08

vAAAGTCTbb

VVAGACTTTB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 4
(ecDNA)
Mean nb of predicted sites per peak: 4.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_test_vs_ctrl_m5

k-mer sig=7.62; evalue=2.4e-08

CrCGCCCACCGkm

KMCGGTGGGCGYG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 2
(ecDNA)
Mean nb of predicted sites per peak: 2.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_7nt_test_vs_ctrl_m1

k-mer sig=9.83; evalue=1.5e-10

sssCCAGAAArks

SMYTTTCTGGSSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 4
(ecDNA)
Mean nb of predicted sites per peak: 4.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_7nt_test_vs_ctrl_m2

k-mer sig=9.83; evalue=1.5e-10

vKCmmAmmGTCTTyw

WRAAGACKKTKKGMB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 3
(ecDNA)
Mean nb of predicted sites per peak: 3.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_test_vs_ctrl_m3

k-mer sig=6.31; evalue=4.9e-07

kvRACCTCAGmh

DKCTGAGGTYBM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 3
(ecDNA)
Mean nb of predicted sites per peak: 3.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_test_vs_ctrl_m4

k-mer sig=6.31; evalue=4.9e-07

ccctCATCACCAcar

YTGTGGTGATGAGGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 6
(ecDNA)
Mean nb of predicted sites per peak: 6.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_7nt_test_vs_ctrl_m5

k-mer sig=2.92; evalue=0.0012

rsGSTTGAArG

CYTTCAASCSY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1 (100.00%)
Max nb of predicted sites per peak: 4
(ecDNA)
Mean nb of predicted sites per peak: 4.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Predicted sites on test peaks (all motifs)

[tab]
[bed]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J. (2012). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Res 40(4): e31.
Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012). A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets using peak-motifs. Nat Protoc 7(8): 1551-1568.

RSAT - peak-motifs result

Analysis: myc_ecDNA (24/06/2025 14:14)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results