peak-motifs GRF3

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: tatttta (sig=81.48; e-value=3.3e-82)	RC: taaaata
oligos_6nt_mkv4_m2	assembly: tattttgt (sig=34.59; e-value=2.6e-35)	RC: acaaaata
oligos_6nt_mkv4_m3	assembly: tattttct (sig=19.83; e-value=1.5e-20)	RC: agaaaata
oligos_6nt_mkv4_m4	assembly: acaaaaca (sig=18.29; e-value=5.1e-19)	RC: tgttttgt
oligos_6nt_mkv4_m5	assembly: tcaaatta (sig=14.68; e-value=2.1e-15)	RC: taatttga

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: aaataaaaaatataaattaa (sig=300; e-value=1e-300)	RC: ttaatttatattttttattt
positions_6nt_m2	assembly: ttaaaataaaaaattaaatt (sig=300; e-value=1e-300)	RC: aatttaattttttattttaa
positions_6nt_m3	assembly: aaacaaaaaataaaaagaaa (sig=300; e-value=1e-300)	RC: tttctttttattttttgttt
positions_6nt_m4	assembly: aaaagaaaaaataaaaagta (sig=300; e-value=1e-300)	RC: tactttttattttttctttt
positions_6nt_m5	assembly: aattaaaataaaaaattatt (sig=300; e-value=1e-300)	RC: aataattttttattttaatt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: tattttta (sig=112.47; e-value=3.4e-113)	RC: taaaaata
oligos_7nt_mkv5_m2	assembly: ctttttctt (sig=30.83; e-value=1.5e-31)	RC: aagaaaaag
oligos_7nt_mkv5_m3	assembly: gttttta (sig=25.62; e-value=2.4e-26)	RC: taaaaac
oligos_7nt_mkv5_m4	assembly: tatttttgtc (sig=24.85; e-value=1.4e-25)	RC: gacaaaaata
oligos_7nt_mkv5_m5	assembly: cttttta (sig=17.27; e-value=5.4e-18)	RC: taaaaag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: ataaaaaaataaaatatttt (sig=300; e-value=1e-300)	RC: aaaatattttatttttttat
positions_7nt_m2	assembly: aaaagaaaaaaataaaaaac (sig=300; e-value=1e-300)	RC: gttttttatttttttctttt
positions_7nt_m3	assembly: aaacaaaaaaataaaaaact (sig=300; e-value=1e-300)	RC: agttttttatttttttgttt
positions_7nt_m4	assembly: attaaaaataaaaaaattaa (sig=300; e-value=1e-300)	RC: ttaatttttttatttttaat
positions_7nt_m5	assembly: ttaaatttaa (sig=7.20; e-value=6.3e-08)	RC: ttaaatttaa

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=81.48; evalue=3.3e-82

wwtattttasw

WSTAAAATAWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 379 (2.28%)
Max nb of predicted sites per peak: 3
(1:4431402-4431551)
Mean nb of predicted sites per peak: 1.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=34.59; evalue=2.6e-35

dwtattttGkrr

YYMCAAAATAWH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1541 (9.29%)
Max nb of predicted sites per peak: 8
(3:10476257-10476890)
Mean nb of predicted sites per peak: 1.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=19.83; evalue=1.5e-20

kwtattttCtmm

KKAGAAAATAWM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1492 (8.99%)
Max nb of predicted sites per peak: 6
(1:25976158-25976896)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=18.29; evalue=5.1e-19

mvmCaaaaCaam

KTTGTTTTGKBK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1484 (8.94%)
Max nb of predicted sites per peak: 8
(3:19765427-19766167)
Mean nb of predicted sites per peak: 1.15

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=14.68; evalue=2.1e-15

tmtCaaattaky

RMTAATTTGAKA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 618 (3.72%)
Max nb of predicted sites per peak: 3
(3:16172670-16173018)
Mean nb of predicted sites per peak: 1.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=300; evalue=1e-300

aaaaataaaaaatataaattaaaa

TTTTAATTTATATTTTTTATTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 804 (4.85%)
Max nb of predicted sites per peak: 4
(4:16436-17056)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=300; evalue=1e-300

aattaaaataaaaaattaaattra

TYAATTTAATTTTTTATTTTAATT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 652 (3.93%)
Max nb of predicted sites per peak: 6
(4:16436-17056)
Mean nb of predicted sites per peak: 1.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=300; evalue=1e-300

amaaaCaaaaaataaaaaGaaaaa

TTTTTCTTTTTATTTTTTGTTTKT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1733 (10.44%)
Max nb of predicted sites per peak: 5
(1:7822529-7822919)
Mean nb of predicted sites per peak: 1.17

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=300; evalue=1e-300

aaaaaaGaaaaaataaaaaGaarr

YYTTCTTTTTATTTTTTCTTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1374 (8.28%)
Max nb of predicted sites per peak: 5
(1:7822529-7822919)
Mean nb of predicted sites per peak: 1.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=300; evalue=1e-300

maaattaaaataaaaaattattrr

YYAATAATTTTTTATTTTAATTTK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 749 (4.51%)
Max nb of predicted sites per peak: 3
(4:16436-17056)
Mean nb of predicted sites per peak: 1.05

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=112.47; evalue=3.4e-113

tttatttttakt

AMTAAAAATAAA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 336 (2.02%)
Max nb of predicted sites per peak: 3
(1:912385-913087)
Mean nb of predicted sites per peak: 1.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=30.83; evalue=1.5e-31

ytCttyttCttcy

RGAAGAARAAGAR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1326 (7.99%)
Max nb of predicted sites per peak: 73
(5:12710330-12710792)
Mean nb of predicted sites per peak: 1.57

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=25.62; evalue=2.4e-26

kkGtttttara

TYTAAAAACMM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1133 (6.83%)
Max nb of predicted sites per peak: 6
(3:10295448-10296725)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=24.85; evalue=1.4e-25

katatttttGtbrk

MYVACAAAAATATM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1214 (7.32%)
Max nb of predicted sites per peak: 6
(4:2468341-2468964)
Mean nb of predicted sites per peak: 1.09

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=17.27; evalue=5.4e-18

wwCtttttawm

KWTAAAAAGWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 956 (5.76%)
Max nb of predicted sites per peak: 7
(2:7381204-7381738)
Mean nb of predicted sites per peak: 1.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=300; evalue=1e-300

mvataaaaaaataaaawawtttaa

TTAAAWTWTTTTATTTTTTTATBK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 662 (3.99%)
Max nb of predicted sites per peak: 4
(1:7822529-7822919)
Mean nb of predicted sites per peak: 1.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=300; evalue=1e-300

aaaaaaRaaaaaaataaaaaacmr

YKGTTTTTTATTTTTTTYTTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1987 (11.97%)
Max nb of predicted sites per peak: 29
(2:9723175-9723446)
Mean nb of predicted sites per peak: 2.87

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=300; evalue=1e-300

mmmmmCaaaaaaataaaaaacara

TYTGTTTTTTATTTTTTTGKKKKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1825 (11.00%)
Max nb of predicted sites per peak: 5
(1:7822529-7822919)
Mean nb of predicted sites per peak: 1.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=300; evalue=1e-300

mmawwaaaaataaaaaaatwaarr

YYTTWATTTTTTTATTTTTWWTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 687 (4.14%)
Max nb of predicted sites per peak: 5
(1:7822529-7822919)
Mean nb of predicted sites per peak: 1.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=7.20; evalue=6.3e-08

trttaaatttaaym

KRTTAAATTTAAYA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 199 (1.20%)
Max nb of predicted sites per peak: 4
(5:9558783-9559379)
Mean nb of predicted sites per peak: 2.05

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: GRF3 (18/07/2025 11:20)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results