peak-motifs teaching

motif discovery

oligos_6nt_mkv3

oligos_6nt_mkv3_m1	assembly: ggacatgcccaggcatgtcc (sig=29.08; e-value=8.3e-30)	RC: ggacatgcctgggcatgtcc
oligos_6nt_mkv3_m2	assembly: gacaagtc (sig=12.90; e-value=1.3e-13)	RC: gacttgtc
oligos_6nt_mkv3_m3	assembly: ggacatgtcc (sig=23.20; e-value=6.3e-24)	RC: ggacatgtcc
oligos_6nt_mkv3_m4	assembly: caaagaaa (sig=6.62; e-value=2.4e-07)	RC: tttctttg
oligos_6nt_mkv3_m5	assembly: aaggaagg (sig=6.09; e-value=8.1e-07)	RC: ccttcctt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: tggacatgcccag (sig=29.28; e-value=5.2e-30)	RC: ctgggcatgtcca
positions_6nt_m2	assembly: aacatgcccag (sig=29.28; e-value=5.2e-30)	RC: ctgggcatgtt
positions_6nt_m3	assembly: ccagacatgcccag (sig=29.28; e-value=5.2e-30)	RC: ctgggcatgtctgg
positions_6nt_m4	assembly: tggacatgtcca (sig=28.40; e-value=4e-29)	RC: tggacatgtcca
positions_6nt_m5	assembly: aggcatgtcca (sig=29.28; e-value=5.2e-30)	RC: tggacatgcct

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv4

oligos_7nt_mkv4_m1	assembly: ggacatgcccaggca (sig=13.80; e-value=1.6e-14)	RC: tgcctgggcatgtcc
oligos_7nt_mkv4_m2	assembly: cccagaca (sig=5.15; e-value=7.1e-06)	RC: tgtctggg
oligos_7nt_mkv4_m3	assembly: gacaagtc (sig=3.72; e-value=0.00019)	RC: gacttgtc
oligos_7nt_mkv4_m4	assembly: caagccc (sig=3.04; e-value=0.00091)	RC: gggcttg
oligos_7nt_mkv4_m5	assembly: gacttgcc (sig=1.63; e-value=0.023)	RC: ggcaagtc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: cagacatgcccag (sig=23.01; e-value=9.8e-24)	RC: ctgggcatgtctg
positions_7nt_m2	assembly: ctgggcatgtcc (sig=23.01; e-value=9.8e-24)	RC: ggacatgcccag
positions_7nt_m3	assembly: cagacatgtctg (sig=8.60; e-value=2.5e-09)	RC: cagacatgtctg
positions_7nt_m4	assembly: aggcatgtctg (sig=23.01; e-value=9.8e-24)	RC: cagacatgcct
positions_7nt_m5	assembly: ctgggcatgcccag (sig=11.29; e-value=5.1e-12)	RC: ctgggcatgcccag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv3_m1

k-mer sig=29.08; evalue=8.3e-30

skrGrCATGYCCrGrCATGyCyms

SKRGRCATGYCYGGRCATGYCYMS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 498 (64.34%)
Max nb of predicted sites per peak: 6
(chr19:53798420-53798777)
Mean nb of predicted sites per peak: 2.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv3_m2

k-mer sig=12.90; evalue=1.3e-13

yrgaCAAGTCys

SRGACTTGTCYR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 228 (29.46%)
Max nb of predicted sites per peak: 4
(chr6:81245927-81246398)
Mean nb of predicted sites per peak: 1.43

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv3_m3

k-mer sig=23.20; evalue=6.3e-24

cyrGACATGTCyrg

CYRGACATGTCYRG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 295 (38.11%)
Max nb of predicted sites per peak: 6
(chr9:114907023-114907448)
Mean nb of predicted sites per peak: 2.38

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv3_m4

k-mer sig=6.62; evalue=2.4e-07

waCAAAGAAAaa

TTTTTCTTTGTW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 122 (15.76%)
Max nb of predicted sites per peak: 9
(chr9:95562591-95562910)
Mean nb of predicted sites per peak: 1.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv3_m5

k-mer sig=6.09; evalue=8.1e-07

rwAAGGAAggrw

WYCCTTCCTTWY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 106 (13.70%)
Max nb of predicted sites per peak: 4
(chr20:46005870-46006271)
Mean nb of predicted sites per peak: 1.21

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=29.28; evalue=5.2e-30

ycyrGACATGCCCagrc

GYCTGGGCATGTCYRGR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 431 (55.68%)
Max nb of predicted sites per peak: 14
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.84

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=29.28; evalue=5.2e-30

crrACATGCCCagrc

GYCTGGGCATGTYYG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 439 (56.72%)
Max nb of predicted sites per peak: 14
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.57

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=29.28; evalue=5.2e-30

gyccrGACATGCCCagrc

GYCTGGGCATGTCYGGRC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 430 (55.56%)
Max nb of predicted sites per peak: 13
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.97

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=28.40; evalue=4e-29

ycygGACATGTCcrgr

YCYGGACATGTCCRGR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 322 (41.60%)
Max nb of predicted sites per peak: 6
(chr7:121151205-121151434)
Mean nb of predicted sites per peak: 2.35

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=29.28; evalue=5.2e-30

cyrGGCATGTCyagr

YCTRGACATGCCYRG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 383 (49.48%)
Max nb of predicted sites per peak: 13
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.86

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv4_m1

k-mer sig=13.80; evalue=1.6e-14

skgGACATGCCCAGrCawG

CWTGYCTGGGCATGTCCMS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 483 (62.40%)
Max nb of predicted sites per peak: 6
(chr19:53798420-53798777)
Mean nb of predicted sites per peak: 1.90

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv4_m2

k-mer sig=5.15; evalue=7.1e-06

tgCCCAGACAtg

CATGTCTGGGCA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 299 (38.63%)
Max nb of predicted sites per peak: 3
(chr3:42864869-42865264)
Mean nb of predicted sites per peak: 1.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv4_m3

k-mer sig=3.72; evalue=0.00019

yrGACAAGTCyv

BRGACTTGTCYR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 239 (30.88%)
Max nb of predicted sites per peak: 4
(chr8:124624563-124624939)
Mean nb of predicted sites per peak: 1.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv4_m4

k-mer sig=3.04; evalue=0.00091

grCAaGCCCrs

SYGGGCTTGYC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 282 (36.43%)
Max nb of predicted sites per peak: 11
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.35

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv4_m5

k-mer sig=1.63; evalue=0.023

srGACwTGCCyr

YRGGCAWGTCYS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 283 (36.56%)
Max nb of predicted sites per peak: 4
(chr7:33327416-33327901)
Mean nb of predicted sites per peak: 1.46

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=23.01; evalue=9.8e-24

yccaGACATGCCCagrc

GYCTGGGCATGTCTGGR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 420 (54.26%)
Max nb of predicted sites per peak: 15
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.78

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=23.01; evalue=9.8e-24

gyctGGGCATGTCyrg

CYRGACATGCCCAGRC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 438 (56.59%)
Max nb of predicted sites per peak: 13
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.71

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=8.60; evalue=2.5e-09

yyCAGACATGTCTGrr

YYCAGACATGTCTGRR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 226 (29.20%)
Max nb of predicted sites per peak: 6
(chr7:121151205-121151434)
Mean nb of predicted sites per peak: 2.38

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=23.01; evalue=9.8e-24

cyrGGCATGTCTggr

YCCAGACATGCCYRG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 358 (46.25%)
Max nb of predicted sites per peak: 11
(chr2:1492533-1493228)
Mean nb of predicted sites per peak: 1.75

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=11.29; evalue=5.1e-12

gyctGGGCATGCCCagrc

GYCTGGGCATGCCCAGRC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 298 (38.50%)
Max nb of predicted sites per peak: 11
(chr13:20936776-20937061)
Mean nb of predicted sites per peak: 2.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: teaching (28/10/2025 14:51)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results