peak-motifs zbtb24

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: caggacctg (sig=85.97; e-value=1.1e-86)	RC: caggtcctg
oligos_6nt_mkv4_m2	assembly: cgcccg (sig=35.59; e-value=2.6e-36)	RC: cgggcg
oligos_6nt_mkv4_m3	assembly: cggagc (sig=34.50; e-value=3.2e-35)	RC: gctccg
oligos_6nt_mkv4_m4	assembly: cgagcg (sig=33.73; e-value=1.9e-34)	RC: cgctcg
oligos_6nt_mkv4_m5	assembly: cggccg (sig=29.59; e-value=2.6e-30)	RC: cggccg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: gcaggtcctgccaggacctg (sig=38.08; e-value=8.3e-39)	RC: caggtcctggcaggacctgc
positions_6nt_m2	assembly: cagggcc (sig=5.21; e-value=6.2e-06)	RC: ggccctg
positions_6nt_m3	assembly: cctggcaggtcctgga (sig=38.08; e-value=8.3e-39)	RC: tccaggacctgccagg
positions_6nt_m4	assembly: ccccgccc (sig=4.51; e-value=3.1e-05)	RC: gggcgggg
positions_6nt_m5	assembly: ggcaggtcctgccaggaccc (sig=38.08; e-value=8.3e-39)	RC: gggtcctggcaggacctgcc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: tccaggacctgg (sig=51.08; e-value=8.3e-52)	RC: ccaggtcctgga
oligos_7nt_mkv5_m2	assembly: attttta (sig=35.28; e-value=5.2e-36)	RC: taaaaat
oligos_7nt_mkv5_m3	assembly: cgccctc (sig=22.79; e-value=1.6e-23)	RC: gagggcg
oligos_7nt_mkv5_m4	assembly: cgccccc (sig=20.06; e-value=8.7e-21)	RC: gggggcg
oligos_7nt_mkv5_m5	assembly: cgcaggcg (sig=19.03; e-value=9.3e-20)	RC: cgcctgcg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: cctgccaggacctgg (sig=22.94; e-value=1.1e-23)	RC: ccaggtcctggcagg
positions_7nt_m2	assembly: cctgccaggaccc (sig=13.85; e-value=1.4e-14)	RC: gggtcctggcagg
positions_7nt_m3	assembly: cagggcct (sig=3.41; e-value=0.00039)	RC: aggccctg
positions_7nt_m4	assembly: aaggacctgg (sig=22.94; e-value=1.1e-23)	RC: ccaggtcctt
positions_7nt_m5	assembly: ctggaagg (sig=2.46; e-value=0.0035)	RC: ccttccag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=85.97; evalue=1.1e-86

kcCAGGACCTggs

SCCAGGTCCTGGM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3062 (18.91%)
Max nb of predicted sites per peak: 30
(chr8:1298519-1299565)
Mean nb of predicted sites per peak: 1.56

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=35.59; evalue=2.6e-36

ssCGCCCGss

SSCGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2534 (15.65%)
Max nb of predicted sites per peak: 25
(chr21:9825635-9826277)
Mean nb of predicted sites per peak: 2.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=34.50; evalue=3.2e-35

ssCGGAGCss

SSGCTCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2015 (12.44%)
Max nb of predicted sites per peak: 15
(chr7:106300337-106301503)
Mean nb of predicted sites per peak: 1.80

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=33.73; evalue=1.9e-34

ssCGaGCGss

SSCGCTCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2171 (13.41%)
Max nb of predicted sites per peak: 33
(chr8:1298519-1299565)
Mean nb of predicted sites per peak: 2.39

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=29.59; evalue=2.6e-30

ssCGGCCGss

SSCGGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1903 (11.75%)
Max nb of predicted sites per peak: 32
(chr10:21805613-21806014)
Mean nb of predicted sites per peak: 3.75

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=38.08; evalue=8.3e-39

ssscaGGtCCTGcCAGGACCTggs

SCCAGGTCCTGGCAGGACCTGSSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1554 (9.60%)
Max nb of predicted sites per peak: 20
(chr8:1298519-1299565)
Mean nb of predicted sites per peak: 1.71

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=5.21; evalue=6.2e-06

ssCAGGGCCss

SSGGCCCTGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1792 (11.07%)
Max nb of predicted sites per peak: 7
(chr3:126194146-126194747)
Mean nb of predicted sites per peak: 1.30

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=38.08; evalue=8.3e-39

sscctgscAGGTCCTGgaag

CTTCCAGGACCTGSCAGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2883 (17.81%)
Max nb of predicted sites per peak: 52
(chr8:1298519-1299565)
Mean nb of predicted sites per peak: 1.50

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=4.51; evalue=3.1e-05

ssCCCCGCCCss

SSGGGCGGGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2820 (17.42%)
Max nb of predicted sites per peak: 33
(chr17:63556337-63558493)
Mean nb of predicted sites per peak: 2.56

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=38.08; evalue=8.3e-39

sssscAGGTCCTGcCAGGaCCcgg

CCGGGTCCTGGCAGGACCTGSSSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1809 (11.17%)
Max nb of predicted sites per peak: 19
(chr10:43535843-43536777)
Mean nb of predicted sites per peak: 1.60

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=51.08; evalue=8.3e-52

cttcCAGGACCTGgsa

TSCCAGGTCCTGGAAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3187 (19.68%)
Max nb of predicted sites per peak: 25
(chr8:1286541-1288097)
Mean nb of predicted sites per peak: 1.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=35.28; evalue=5.2e-36

wwATTTTTAww

WWTAAAAATWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2306 (14.24%)
Max nb of predicted sites per peak: 10
(chr1:236252663-236253942)
Mean nb of predicted sites per peak: 1.30

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=22.79; evalue=1.6e-23

ssCGCCCTCss

SSGAGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2247 (13.88%)
Max nb of predicted sites per peak: 16
(chr17:63556337-63558493)
Mean nb of predicted sites per peak: 1.72

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=20.06; evalue=8.7e-21

ssCGCCCCCss

SSGGGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2724 (16.82%)
Max nb of predicted sites per peak: 30
(chr17:63556337-63558493)
Mean nb of predicted sites per peak: 2.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=19.03; evalue=9.3e-20

ssCGCaGGCGss

SSCGCCTGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2109 (13.02%)
Max nb of predicted sites per peak: 32
(chr4:141676881-141677523)
Mean nb of predicted sites per peak: 3.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=22.94; evalue=1.1e-23

smcCtgCCAGGACCTggsv

BSCCAGGTCCTGGCAGGKS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3473 (21.45%)
Max nb of predicted sites per peak: 25
(chr8:1298519-1299565)
Mean nb of predicted sites per peak: 1.32

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=13.85; evalue=1.4e-14

sccCtgCCAGGACCyks

SMRGGTCCTGGCAGGGS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3482 (21.50%)
Max nb of predicted sites per peak: 30
(chr8:1298519-1299565)
Mean nb of predicted sites per peak: 1.23

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=3.41; evalue=0.00039

ssCAGGgCCTgs

SCAGGCCCTGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2992 (18.48%)
Max nb of predicted sites per peak: 19
(chr10:43535843-43536777)
Mean nb of predicted sites per peak: 1.49

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=22.94; evalue=1.1e-23

kcmAGGACCTGgva

TBCCAGGTCCTKGM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3094 (19.11%)
Max nb of predicted sites per peak: 26
(chr4:189423933-189431434)
Mean nb of predicted sites per peak: 1.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=2.46; evalue=0.0035

wcCTGGAAGGrv

BYCCTTCCAGGW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1112 (6.87%)
Max nb of predicted sites per peak: 23
(chr8:1410888-1413686)
Mean nb of predicted sites per peak: 1.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: zbtb24 (25/11/2025 17:53)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results