peak-motifs empty

motif discovery

oligos_6nt_mkv3

oligos_6nt_mkv3_m1	assembly: ttcagcaccatggtgctgaa (sig=89.76; e-value=1.7e-90)	RC: ttcagcaccatggtgctgaa
oligos_6nt_mkv3_m2	assembly: cgctgtccattcgat (sig=88.91; e-value=1.2e-89)	RC: atcgaatggacagcg
oligos_6nt_mkv3_m3	assembly: atcgaatggaat (sig=32.57; e-value=2.7e-33)	RC: attccattcgat
oligos_6nt_mkv3_m4	assembly: ttcagcaccacggacagcg (sig=89.76; e-value=1.7e-90)	RC: cgctgtccgtggtgctgaa
oligos_6nt_mkv3_m5	assembly: gcggcggggcgg (sig=21.30; e-value=5e-22)	RC: ccgccccgccgc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: gggagctgtccatggacagc (sig=35.17; e-value=6.8e-36)	RC: gctgtccatggacagctccc
positions_6nt_m2	assembly: ttcagcaccac (sig=26.51; e-value=3.1e-27)	RC: gtggtgctgaa
positions_6nt_m3	assembly: ggccccgccccc (sig=8.59; e-value=2.6e-09)	RC: gggggcggggcc
positions_6nt_m4	assembly: ggccccgccgccccc (sig=8.59; e-value=2.6e-09)	RC: gggggcggcggggcc
positions_6nt_m5	assembly: gagctgtccatggacagcgc (sig=35.17; e-value=6.8e-36)	RC: gcgctgtccatggacagctc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv4

oligos_7nt_mkv4_m1	assembly: gcgctgtccgtggtgctgaa (sig=136.60; e-value=2.5e-137)	RC: ttcagcaccacggacagcgc
oligos_7nt_mkv4_m2	assembly: ggaatcgaatggaatc (sig=40.04; e-value=9.1e-41)	RC: gattccattcgattcc
oligos_7nt_mkv4_m3	assembly: ggcgctgtccatg (sig=63.49; e-value=3.2e-64)	RC: catggacagcgcc
oligos_7nt_mkv4_m4	assembly: tcaggacca (sig=27.01; e-value=9.8e-28)	RC: tggtcctga
oligos_7nt_mkv4_m5	assembly: catggacagctcc (sig=63.49; e-value=3.2e-64)	RC: ggagctgtccatg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: ttcagcacca (sig=22.17; e-value=6.8e-23)	RC: tggtgctgaa
positions_7nt_m2	assembly: ggagctgtcca (sig=21.81; e-value=1.5e-22)	RC: tggacagctcc
positions_7nt_m3	assembly: cgctgtcca (sig=21.81; e-value=1.5e-22)	RC: tggacagcg
positions_7nt_m4	: (sig=; e-value=1)	RC:
positions_7nt_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv3_m1

k-mer sig=89.76; evalue=1.7e-90

ytTTcAkCACCatGGTGmTgAAar

YTTTCAKCACCATGGTGMTGAAAR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 542 (23.13%)
Max nb of predicted sites per peak: 26
(chr10:135500231-135501211)
Mean nb of predicted sites per peak: 3.99

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv3_m2

k-mer sig=88.91; evalue=1.2e-89

ATTsCWkTCCATTccATTc

GAATGGAATGGAMWGSAAT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 316 (13.49%)
Max nb of predicted sites per peak: 166
(chr10:42372455-42373497)
Mean nb of predicted sites per peak: 52.47

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv3_m3

k-mer sig=32.57; evalue=2.7e-33

GAATgGAATGGAATgg

CCATTCCATTCCATTC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 303 (12.93%)
Max nb of predicted sites per peak: 164
(chr4:49145678-49147739)
Mean nb of predicted sites per peak: 55.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv3_m4

k-mer sig=89.76; evalue=1.7e-90

gkTTCAGcACCAyGGACAGcdcc

GGHGCTGTCCRTGGTGCTGAAMC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 664 (28.34%)
Max nb of predicted sites per peak: 5
(chr11:66188942-66189751)
Mean nb of predicted sites per peak: 1.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv3_m5

k-mer sig=21.30; evalue=5e-22

ssGcGGCGGgGcgggs

SCCCGCCCCGCCGCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 322 (13.74%)
Max nb of predicted sites per peak: 33
(chrUn_gl000220:152898-156668)
Mean nb of predicted sites per peak: 3.31

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=35.17; evalue=6.8e-36

ssgggaGCTGTCCATGgwcAgcds

SHGCTGWCCATGGACAGCTCCCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 461 (19.68%)
Max nb of predicted sites per peak: 4
(chr8:10847500-10848252)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=26.51; evalue=3.1e-27

rtTTCAGCACCAygg

CCRTGGTGCTGAAAY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 707 (30.17%)
Max nb of predicted sites per peak: 6
(chr11:66188942-66189751)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=8.59; evalue=2.6e-09

ccsgCCCCGCCcCsss

SSSGGGGCGGGGCSGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 332 (14.17%)
Max nb of predicted sites per peak: 21
(chrUn_gl000220:152898-156668)
Mean nb of predicted sites per peak: 2.92

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=8.59; evalue=2.6e-09

ccsgCcCCGCCgCccccsc

GSGGGGGCGGCGGGGCSGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 332 (14.17%)
Max nb of predicted sites per peak: 39
(chr21:9825478-9826406)
Mean nb of predicted sites per peak: 4.13

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=35.17; evalue=6.8e-36

gggmGCTGtCCATGGaCAgcgcsc

GSGCGCTGTCCATGGACAGCKCCC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 178 (7.60%)
Max nb of predicted sites per peak: 5
(chr3:49591960-49592361)
Mean nb of predicted sites per peak: 1.39

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv4_m1

k-mer sig=136.60; evalue=2.5e-137

kgghgCTGTCCrTGGTgCTGAAmc

GKTTCAGCACCAYGGACAGCDCCM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 668 (28.51%)
Max nb of predicted sites per peak: 5
(chr19:50490148-50490951)
Mean nb of predicted sites per peak: 1.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv4_m2

k-mer sig=40.04; evalue=9.1e-41

ATgGAATgGAATGGAATggA

TCCATTCCATTCCATTCCAT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 274 (11.69%)
Max nb of predicted sites per peak: 177
(chr4:49150869-49152048)
Mean nb of predicted sites per peak: 66.37

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv4_m3

k-mer sig=63.49; evalue=3.2e-64

bkggmGCTGTCCatGgT

ACCATGGACAGCKCCMV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 760 (32.44%)
Max nb of predicted sites per peak: 5
(chr11:66188942-66189751)
Mean nb of predicted sites per peak: 1.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv4_m4

k-mer sig=27.01; evalue=9.8e-28

ttTCAGsACCAyg

CRTGGTSCTGAAA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 659 (28.13%)
Max nb of predicted sites per peak: 5
(chr19:50490148-50490951)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv4_m5

k-mer sig=63.49; evalue=3.2e-64

AccatGGACAGCkcCmm

KKGGMGCTGTCCATGGT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 763 (32.57%)
Max nb of predicted sites per peak: 5
(chr11:66188942-66189751)
Mean nb of predicted sites per peak: 1.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=22.17; evalue=6.8e-23

gtTTCAGCACCAyg

CRTGGTGCTGAAAC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 687 (29.32%)
Max nb of predicted sites per peak: 5
(chr19:50490148-50490951)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=21.81; evalue=1.5e-22

tkrgmGCTGTCCAwg

CWTGGACAGCKCYMA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 689 (29.41%)
Max nb of predicted sites per peak: 3
(chr7:154861449-154862087)
Mean nb of predicted sites per peak: 1.09

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=21.81; evalue=1.5e-22

rghGCTGTCCAwg

CWTGGACAGCDCY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 662 (28.25%)
Max nb of predicted sites per peak: 3
(chr8:28514877-28515085)
Mean nb of predicted sites per peak: 1.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: empty (26/11/2025 20:45)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results