peak-motifs RUNX1

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: cgcccg (sig=226.51; e-value=3.1e-227)	RC: cgggcg
oligos_6nt_mkv4_m2	assembly: cggccg (sig=178.98; e-value=1e-179)	RC: cggccg
oligos_6nt_mkv4_m3	assembly: cgagcg (sig=172.50; e-value=3.2e-173)	RC: cgctcg
oligos_6nt_mkv4_m4	assembly: cttttc (sig=161.90; e-value=1.3e-162)	RC: gaaaag
oligos_6nt_mkv4_m5	assembly: cggagc (sig=143.65; e-value=2.2e-144)	RC: gctccg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: cgctccggcccccgctcggc (sig=300; e-value=1e-300)	RC: gccgagcgggggccggagcg
positions_6nt_m2	assembly: agggcggccgggct (sig=300; e-value=1e-300)	RC: agcccggccgccct
positions_6nt_m3	assembly: gacccgctgg (sig=300; e-value=1e-300)	RC: ccagcgggtc
positions_6nt_m4	assembly: gccgagcgccgggacgcg (sig=300; e-value=1e-300)	RC: cgcgtcccggcgctcggc
positions_6nt_m5	assembly: aggccgcagg (sig=300; e-value=1e-300)	RC: cctgcggcct

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: attttta (sig=164.08; e-value=8.3e-165)	RC: taaaaat
oligos_7nt_mkv5_m2	assembly: cgccccc (sig=125.26; e-value=5.5e-126)	RC: gggggcg
oligos_7nt_mkv5_m3	assembly: cgccctc (sig=107.85; e-value=1.4e-108)	RC: gagggcg
oligos_7nt_mkv5_m4	assembly: cggcagc (sig=92.73; e-value=1.9e-93)	RC: gctgccg
oligos_7nt_mkv5_m5	assembly: ccccgccc (sig=91.56; e-value=2.8e-92)	RC: gggcgggg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: gctccgcgcggagc (sig=300; e-value=1e-300)	RC: gctccgcgcggagc
positions_7nt_m2	assembly: cgggcccggccccgccgccg (sig=300; e-value=1e-300)	RC: cggcggcggggccgggcccg
positions_7nt_m3	assembly: ctccccgccccggccccgcg (sig=300; e-value=1e-300)	RC: cgcggggccggggcggggag
positions_7nt_m4	assembly: ggaggcggccccggcccggc (sig=300; e-value=1e-300)	RC: gccgggccggggccgcctcc
positions_7nt_m5	assembly: gagggcggcga (sig=300; e-value=1e-300)	RC: tcgccgccctc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=226.51; evalue=3.1e-227

ssCGCCCGss

SSCGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 23056 (16.61%)
Max nb of predicted sites per peak: 28
(chr19:47363154-47364158)
Mean nb of predicted sites per peak: 2.19

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=178.98; evalue=1e-179

ssCGGCCGss

SSCGGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 17351 (12.50%)
Max nb of predicted sites per peak: 38
(chr2:90449583-90450431)
Mean nb of predicted sites per peak: 3.43

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=172.50; evalue=3.2e-173

ssCGrGCGcg

CGCGCYCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 22639 (16.31%)
Max nb of predicted sites per peak: 28
(chr19:47363154-47364158)
Mean nb of predicted sites per peak: 2.13

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=161.90; evalue=1.3e-162

ttCTTTTCyt

ARGAAAAGAA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 12603 (9.08%)
Max nb of predicted sites per peak: 21
(chr12:114808039-114808221)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=143.65; evalue=2.2e-144

sgCGGAGCss

SSGCTCCGCS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13876 (10.00%)
Max nb of predicted sites per peak: 17
(chr10:38691716-38692200)
Mean nb of predicted sites per peak: 1.52

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=300; evalue=1e-300

sscGCtCcgsCCCCCGCyCgGCss

SSGCCGRGCGGGGGSCGGAGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 18588 (13.39%)
Max nb of predicted sites per peak: 107
(chr15:99191776-99192682)
Mean nb of predicted sites per peak: 4.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=300; evalue=1e-300

gsaGGGCGGCCGGGCtsr

YSAGCCCGGCCGCCCTSC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13085 (9.43%)
Max nb of predicted sites per peak: 34
(chr3:23987044-23988262)
Mean nb of predicted sites per peak: 2.72

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=300; evalue=1e-300

sgGACCCGCTGGss

SSCCAGCGGGTCCS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 8132 (5.86%)
Max nb of predicted sites per peak: 10
(chr20:62138774-62139044)
Mean nb of predicted sites per peak: 1.31

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=300; evalue=1e-300

krGCCGrGCGCsGkGrCGsGsg

CSCSCGYCMCSGCGCYCGGCYM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 26337 (18.98%)
Max nb of predicted sites per peak: 73
(chr15:99191776-99192682)
Mean nb of predicted sites per peak: 2.74

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=300; evalue=1e-300

ssAGGCCGCAGGss

SSCCTGCGGCCTSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 10863 (7.83%)
Max nb of predicted sites per peak: 18
(chr7:158199836-158200230)
Mean nb of predicted sites per peak: 1.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=164.08; evalue=8.3e-165

twATTTTTAdw

WHTAAAAATWA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 42232 (30.43%)
Max nb of predicted sites per peak: 36
(chr12:23990367-23990633)
Mean nb of predicted sites per peak: 1.77

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=125.26; evalue=5.5e-126

ssCGCCCCCss

SSGGGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 25244 (18.19%)
Max nb of predicted sites per peak: 30
(chr9:129375592-129376542)
Mean nb of predicted sites per peak: 2.27

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=107.85; evalue=1.4e-108

sbCGCCCTCcc

GGGAGGGCGVS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 24717 (17.81%)
Max nb of predicted sites per peak: 37
(chr15:100467134-100467705)
Mean nb of predicted sites per peak: 1.61

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=92.73; evalue=1.9e-93

ssCGGCAGCss

SSGCTGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 10394 (7.49%)
Max nb of predicted sites per peak: 32
(chr16:12009292-12010309)
Mean nb of predicted sites per peak: 2.13

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=91.56; evalue=2.8e-92

csCCCCGCCCss

SSGGGCGGGGSG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 22866 (16.48%)
Max nb of predicted sites per peak: 37
(chr1:15850658-15851894)
Mean nb of predicted sites per peak: 2.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=300; evalue=1e-300

ssGCtCCGCGCGGaGCss

SSGCTCCGCGCGGAGCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 10358 (7.46%)
Max nb of predicted sites per peak: 78
(chr9:129375592-129376542)
Mean nb of predicted sites per peak: 4.95

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=300; evalue=1e-300

sscgsgCCCGsCcCCGCcsCCGss

SSCGGSGGCGGGGSCGGGCSCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 22337 (16.09%)
Max nb of predicted sites per peak: 209
(chr2:33141222-33141733)
Mean nb of predicted sites per peak: 5.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=300; evalue=1e-300

csCtCCCCGCCcCggCCcCgCgss

SSCGCGGGGCCGGGGCGGGGAGSG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 22553 (16.25%)
Max nb of predicted sites per peak: 345
(chr2:33141222-33141733)
Mean nb of predicted sites per peak: 4.36

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=300; evalue=1e-300

ssGGmGGCGGCccCGGCccgGCss

SSGCCGGGCCGGGGCCGCCKCCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13526 (9.75%)
Max nb of predicted sites per peak: 124
(chr9:129375592-129376542)
Mean nb of predicted sites per peak: 6.96

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=300; evalue=1e-300

ssGaGGGCGGCGasg

CSTCGCCGCCCTCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 13023 (9.38%)
Max nb of predicted sites per peak: 42
(chr15:99191776-99192682)
Mean nb of predicted sites per peak: 2.67

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: RUNX1_RSAT (18/12/2025 08:55)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results