peak-motifs zbtb_test

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: caggacctg (sig=87.66; e-value=2.2e-88)	RC: caggtcctg
oligos_6nt_mkv4_m2	assembly: cgcccg (sig=34.35; e-value=4.5e-35)	RC: cgggcg
oligos_6nt_mkv4_m3	assembly: cggagc (sig=34.01; e-value=9.8e-35)	RC: gctccg
oligos_6nt_mkv4_m4	assembly: cgagcg (sig=33.85; e-value=1.4e-34)	RC: cgctcg
oligos_6nt_mkv4_m5	assembly: cggccg (sig=29.29; e-value=5.1e-30)	RC: cggccg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: tccaggacctgccagg (sig=37.62; e-value=2.4e-38)	RC: cctggcaggtcctgga
positions_6nt_m2	assembly: agcaggtcctggcagggcc (sig=37.62; e-value=2.4e-38)	RC: ggccctgccaggacctgct
positions_6nt_m3	assembly: ccccgcccc (sig=3.08; e-value=0.00083)	RC: ggggcgggg
positions_6nt_m4	assembly: cttcca (sig=2.69; e-value=0.002)	RC: tggaag
positions_6nt_m5	assembly: cctggcaggacctgccagga (sig=37.62; e-value=2.4e-38)	RC: tcctggcaggtcctgccagg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: tccaggacctgg (sig=52.04; e-value=9.1e-53)	RC: ccaggtcctgga
oligos_7nt_mkv5_m2	assembly: attttta (sig=36.40; e-value=4e-37)	RC: taaaaat
oligos_7nt_mkv5_m3	assembly: cgccctcg (sig=23.41; e-value=3.9e-24)	RC: cgagggcg
oligos_7nt_mkv5_m4	assembly: cgccccc (sig=21.29; e-value=5.1e-22)	RC: gggggcg
oligos_7nt_mkv5_m5	assembly: cgcaggcg (sig=19.07; e-value=8.5e-20)	RC: cgcctgcg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: cctgccaggacctgg (sig=22.94; e-value=1.1e-23)	RC: ccaggtcctggcagg
positions_7nt_m2	assembly: cctgccaggaccc (sig=14.26; e-value=5.5e-15)	RC: gggtcctggcagg
positions_7nt_m3	assembly: cagggcct (sig=3.90; e-value=0.00013)	RC: aggccctg
positions_7nt_m4	assembly: ctggaag (sig=2.73; e-value=0.0019)	RC: cttccag
positions_7nt_m5	assembly: aaggacctgg (sig=22.94; e-value=1.1e-23)	RC: ccaggtcctt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=87.66; evalue=2.2e-88

kcCAGGACCTggs

SCCAGGTCCTGGM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3103 (18.68%)
Max nb of predicted sites per peak: 30
(chr8:1298519-1299518)
Mean nb of predicted sites per peak: 1.56

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=34.35; evalue=4.5e-35

ssCGCCCGss

SSCGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2588 (15.58%)
Max nb of predicted sites per peak: 21
(chr21:9825771-9826267)
Mean nb of predicted sites per peak: 2.59

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=34.01; evalue=9.8e-35

ssCGGAGCss

SSGCTCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2048 (12.33%)
Max nb of predicted sites per peak: 15
(chr7:106300337-106301503)
Mean nb of predicted sites per peak: 1.82

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=33.85; evalue=1.4e-34

ssCGaGCGss

SSCGCTCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2208 (13.29%)
Max nb of predicted sites per peak: 32
(chr8:1298519-1299518)
Mean nb of predicted sites per peak: 2.39

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=29.29; evalue=5.1e-30

ssCGGCCGss

SSCGGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1948 (11.73%)
Max nb of predicted sites per peak: 32
(chr10:21805613-21806014)
Mean nb of predicted sites per peak: 3.81

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=37.62; evalue=2.4e-38

cttcCAGGACCTgscaggss

SSCCTGSCAGGTCCTGGAAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2916 (17.56%)
Max nb of predicted sites per peak: 51
(chr8:1298519-1299518)
Mean nb of predicted sites per peak: 1.49

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=37.62; evalue=2.4e-38

ssvscAGGTCCTGgcaGggccsg

CSGGCCCTGCCAGGACCTGSBSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3411 (20.54%)
Max nb of predicted sites per peak: 30
(chr8:1298519-1299518)
Mean nb of predicted sites per peak: 1.40

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=3.08; evalue=0.00083

ssCCCCGCCCcss

SSGGGGCGGGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2992 (18.02%)
Max nb of predicted sites per peak: 43
(chr17:63556337-63558493)
Mean nb of predicted sites per peak: 2.92

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=2.69; evalue=0.002

yyCTTCCAgg

CCTGGAAGRR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2510 (15.11%)
Max nb of predicted sites per peak: 25
(chr8:1410888-1413686)
Mean nb of predicted sites per peak: 1.15

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=37.62; evalue=2.4e-38

smcctgsCAGGACCTgscaggass

SSTCCTGSCAGGTCCTGSCAGGKS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2238 (13.48%)
Max nb of predicted sites per peak: 57
(chr8:1298519-1299518)
Mean nb of predicted sites per peak: 1.59

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=52.04; evalue=9.1e-53

cttcCAGGACCTGgsa

TSCCAGGTCCTGGAAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3220 (19.39%)
Max nb of predicted sites per peak: 25
(chr8:1286541-1288097)
Mean nb of predicted sites per peak: 1.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=36.40; evalue=4e-37

wwATTTTTAww

WWTAAAAATWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2346 (14.13%)
Max nb of predicted sites per peak: 10
(chr1:236252663-236253942)
Mean nb of predicted sites per peak: 1.31

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=23.41; evalue=3.9e-24

ssCGCCCtCgss

SSCGAGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2607 (15.70%)
Max nb of predicted sites per peak: 25
(chr17:63556337-63558493)
Mean nb of predicted sites per peak: 2.43

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=21.29; evalue=5.1e-22

ssCGCCCCCss

SSGGGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2700 (16.26%)
Max nb of predicted sites per peak: 30
(chr17:63556337-63558493)
Mean nb of predicted sites per peak: 2.51

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=19.07; evalue=8.5e-20

ssCGCaGGCGss

SSCGCCTGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2147 (12.93%)
Max nb of predicted sites per peak: 32
(chr4:141676881-141677523)
Mean nb of predicted sites per peak: 2.98

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=22.94; evalue=1.1e-23

bmcCtgCCAGGACCTggsv

BSCCAGGTCCTGGCAGGKV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3535 (21.28%)
Max nb of predicted sites per peak: 23
(chr8:1286541-1288097)
Mean nb of predicted sites per peak: 1.31

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=14.26; evalue=5.5e-15

sccCtgCCAGGACCyks

SMRGGTCCTGGCAGGGS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3515 (21.16%)
Max nb of predicted sites per peak: 30
(chr8:1298519-1299518)
Mean nb of predicted sites per peak: 1.23

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=3.90; evalue=0.00013

ssCAGGgCCTgg

CCAGGCCCTGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2901 (17.47%)
Max nb of predicted sites per peak: 19
(chr10:43535843-43536777)
Mean nb of predicted sites per peak: 1.50

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=2.73; evalue=0.0019

wcCTGGAAGtr

YACTTCCAGGW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2095 (12.61%)
Max nb of predicted sites per peak: 24
(chr8:1410888-1413686)
Mean nb of predicted sites per peak: 1.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=22.94; evalue=1.1e-23

kcmAGGACCTGgva

TBCCAGGTCCTKGM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3162 (19.04%)
Max nb of predicted sites per peak: 26
(chr4:189423933-189431434)
Mean nb of predicted sites per peak: 1.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: zbtb_test_jeudi (19/12/2025 03:06)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results