peak-motifs HNF4A-chipseq

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: agcggagc (sig=169.50; e-value=3.2e-170)	RC: gctccgct
oligos_6nt_mkv4_m2	assembly: gcggggcg (sig=123.67; e-value=2.1e-124)	RC: cgccccgc
oligos_6nt_mkv4_m3	assembly: cgcctcg (sig=112.45; e-value=3.5e-113)	RC: cgaggcg
oligos_6nt_mkv4_m4	assembly: cgagcg (sig=105.84; e-value=1.4e-106)	RC: cgctcg
oligos_6nt_mkv4_m5	assembly: cgctgcg (sig=97.45; e-value=3.5e-98)	RC: cgcagcg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: gccccgccgcccc (sig=30.59; e-value=2.6e-31)	RC: ggggcggcggggc
positions_6nt_m2	assembly: gttaaaaaacaa (sig=28.35; e-value=4.5e-29)	RC: ttgttttttaac
positions_6nt_m3	assembly: ggccgccccgccgcgcccgc (sig=30.59; e-value=2.6e-31)	RC: gcgggcgcggcggggcggcc
positions_6nt_m4	assembly: ggcccgccccgcgcccgggg (sig=29.68; e-value=2.1e-30)	RC: ccccgggcgcggggcgggcc
positions_6nt_m5	assembly: ccgcgccgccccgccggaag (sig=30.59; e-value=2.6e-31)	RC: cttccggcggggcggcgcgg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: ccccgccc (sig=125.48; e-value=3.3e-126)	RC: gggcgggg
oligos_7nt_mkv5_m2	assembly: tgcgcctgcg (sig=99.09; e-value=8.1e-100)	RC: cgcaggcgca
oligos_7nt_mkv5_m3	assembly: cgccctcg (sig=96.14; e-value=7.2e-97)	RC: cgagggcg
oligos_7nt_mkv5_m4	assembly: cgcccccg (sig=93.66; e-value=2.2e-94)	RC: cgggggcg
oligos_7nt_mkv5_m5	assembly: tgactca (sig=69.57; e-value=2.7e-70)	RC: tgagtca

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: ctttttttaaaaaaag (sig=19.57; e-value=2.7e-20)	RC: ctttttttaaaaaaag
positions_7nt_m2	assembly: gggcgcgcgccccgcccccg (sig=18.73; e-value=1.9e-19)	RC: cgggggcggggcgcgcgccc
positions_7nt_m3	assembly: acttccggcggcggggcggg (sig=18.73; e-value=1.9e-19)	RC: cccgccccgccgccggaagt
positions_7nt_m4	assembly: tgactca (sig=7.95; e-value=1.1e-08)	RC: tgagtca
positions_7nt_m5	assembly: tccccgggga (sig=7.09; e-value=8.1e-08)	RC: tccccgggga

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=169.50; evalue=3.2e-170

gsagCGGAGCss

SSGCTCCGCTSC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3467 (17.96%)
Max nb of predicted sites per peak: 7
(chr17:65612608-65614318)
Mean nb of predicted sites per peak: 1.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=123.67; evalue=2.1e-124

ggGCGGGGCGsg

CSCGCCCCGCCC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4750 (24.61%)
Max nb of predicted sites per peak: 17
(chr14:115040804-115042525)
Mean nb of predicted sites per peak: 2.37

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=112.45; evalue=3.5e-113

ssCGCCTCgss

SSCGAGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3886 (20.13%)
Max nb of predicted sites per peak: 11
(chr17:15704415-15706139)
Mean nb of predicted sites per peak: 1.76

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=105.84; evalue=1.4e-106

sgCGAGCGcg

CGCGCTCGCS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3831 (19.85%)
Max nb of predicted sites per peak: 28
(chr5:33274068-33275192)
Mean nb of predicted sites per peak: 2.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=97.45; evalue=3.5e-98

ssCGCTGCgss

SSCGCAGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3821 (19.79%)
Max nb of predicted sites per peak: 16
(chr17:15704415-15706139)
Mean nb of predicted sites per peak: 2.48

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=30.59; evalue=2.6e-31

csgCcCCGCCGCcccss

SSGGGGCGGCGGGGCSG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5345 (27.69%)
Max nb of predicted sites per peak: 46
(chr11:107131493-107132324)
Mean nb of predicted sites per peak: 5.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=28.35; evalue=4.5e-29

wwdTTAAAAAAmAAaw

WTTTKTTTTTTAAHWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5076 (26.30%)
Max nb of predicted sites per peak: 66
(chr6:135060598-135060907)
Mean nb of predicted sites per peak: 5.66

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=30.59; evalue=2.6e-31

ssgsCcgCccCGCCgCgccCgCss

SSGCGGGCGCGGCGGGGCGGSCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5413 (28.04%)
Max nb of predicted sites per peak: 92
(chr17:65782557-65784011)
Mean nb of predicted sites per peak: 8.22

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=29.68; evalue=2.1e-30

ssggCCCGCcCCGCgcccgssgcs

SGCSSCGGGCGCGGGGCGGGCCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5257 (27.23%)
Max nb of predicted sites per peak: 91
(chr17:65782557-65784011)
Mean nb of predicted sites per peak: 6.87

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=30.59; evalue=2.6e-31

ssccgCgCCGCccCGCCggmmgss

SSCKKCCGGCGGGGCGGCGCGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4895 (25.36%)
Max nb of predicted sites per peak: 55
(chr17:65782557-65784011)
Mean nb of predicted sites per peak: 5.41

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=125.48; evalue=3.3e-126

ssCCCCGCCCcs

SGGGGCGGGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5214 (27.01%)
Max nb of predicted sites per peak: 16
(chr17:31564499-31565379)
Mean nb of predicted sites per peak: 2.18

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=99.09; evalue=8.1e-100

sstGCGCcTGCGcs

SGCGCAGGCGCASS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3962 (20.53%)
Max nb of predicted sites per peak: 18
(chr5:33274068-33275192)
Mean nb of predicted sites per peak: 2.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=96.14; evalue=7.2e-97

ssCGCCCTCGss

SSCGAGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3794 (19.65%)
Max nb of predicted sites per peak: 11
(chr17:31564499-31565379)
Mean nb of predicted sites per peak: 1.71

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=93.66; evalue=2.2e-94

scCGCCcCCGcc

GGCGGGGGCGGS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4730 (24.50%)
Max nb of predicted sites per peak: 22
(chr17:63499182-63500483)
Mean nb of predicted sites per peak: 2.83

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=69.57; evalue=2.7e-70

wvTGACTCAsw

WSTGAGTCABW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2069 (10.72%)
Max nb of predicted sites per peak: 5
(chr8:84191432-84192878)
Mean nb of predicted sites per peak: 1.22

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=19.57; evalue=2.7e-20

wwhTTTTTTTAAAAAAAdww

WWHTTTTTTTAAAAAAADWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2955 (15.31%)
Max nb of predicted sites per peak: 96
(chr14:20961496-20962769)
Mean nb of predicted sites per peak: 9.32

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=18.73; evalue=1.9e-19

ssssgcgCgcgCcCCGCccccsss

SSSGGGGGCGGGGCGCGCGCSSSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5470 (28.34%)
Max nb of predicted sites per peak: 92
(chr17:65782557-65784011)
Mean nb of predicted sites per peak: 7.59

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=18.73; evalue=1.9e-19

ssacttccGGcGGCGGgGcGGGss

SSCCCGCCCCGCCGCCGGAAGTSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4799 (24.86%)
Max nb of predicted sites per peak: 35
(chr17:65782557-65784011)
Mean nb of predicted sites per peak: 3.86

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=7.95; evalue=1.1e-08

wvTGACTCAsw

WSTGAGTCABW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2069 (10.72%)
Max nb of predicted sites per peak: 5
(chr8:84191432-84192878)
Mean nb of predicted sites per peak: 1.22

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=7.09; evalue=8.1e-08

sstCCCCGGGGass

SSTCCCCGGGGASS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1155 (5.98%)
Max nb of predicted sites per peak: 8
(chrY:90741848-90743085)
Mean nb of predicted sites per peak: 2.24

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: HNF4A-chipseq (19/12/2025 15:37)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results