peak-motifs Asterocyte

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: cgcccg (sig=161.64; e-value=2.3e-162)	RC: cgggcg
oligos_6nt_mkv4_m2	assembly: cgagcg (sig=136.08; e-value=8.3e-137)	RC: cgctcg
oligos_6nt_mkv4_m3	assembly: cggccg (sig=118.90; e-value=1.3e-119)	RC: cggccg
oligos_6nt_mkv4_m4	assembly: ctgggcagggca (sig=110.15; e-value=7.1e-111)	RC: tgccctgcccag
oligos_6nt_mkv4_m5	assembly: cggagcg (sig=105.65; e-value=2.2e-106)	RC: cgctccg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: gctgctgccagccgctccgc (sig=300; e-value=1e-300)	RC: gcggagcggctggcagcagc
positions_6nt_m2	assembly: tgcagcagctgcg (sig=300; e-value=1e-300)	RC: cgcagctgctgca
positions_6nt_m3	assembly: ccgcccggcgcgctgccaag (sig=300; e-value=1e-300)	RC: cttggcagcgcgccgggcgg
positions_6nt_m4	assembly: gccgccccgccgcgcccgcg (sig=300; e-value=1e-300)	RC: cgcgggcgcggcggggcggc
positions_6nt_m5	assembly: ggccaggcc (sig=300; e-value=1e-300)	RC: ggcctggcc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: attttta (sig=106.67; e-value=2.1e-107)	RC: taaaaat
oligos_7nt_mkv5_m2	assembly: cgcccccg (sig=90.02; e-value=9.5e-91)	RC: cgggggcg
oligos_7nt_mkv5_m3	assembly: cgccctcg (sig=73.61; e-value=2.5e-74)	RC: cgagggcg
oligos_7nt_mkv5_m4	assembly: cggctgcg (sig=56.36; e-value=4.4e-57)	RC: cgcagccg
oligos_7nt_mkv5_m5	assembly: cggcccg (sig=53.65; e-value=2.2e-54)	RC: cgggccg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: cgccccgcccgcgcgcggcc (sig=300; e-value=1e-300)	RC: ggccgcgcgcgggcggggcg
positions_7nt_m2	assembly: cggcagccagcc (sig=300; e-value=1e-300)	RC: ggctggctgccg
positions_7nt_m3	assembly: ggggcggccgcggcgcgggc (sig=300; e-value=1e-300)	RC: gcccgcgccgcggccgcccc
positions_7nt_m4	assembly: ggctggcc (sig=300; e-value=1e-300)	RC: ggccagcc
positions_7nt_m5	assembly: aggcagcagctgctgcct (sig=300; e-value=1e-300)	RC: aggcagcagctgctgcct

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=161.64; evalue=2.3e-162

ssCGCcCGss

SSCGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3590 (22.79%)
Max nb of predicted sites per peak: 49
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 6.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=136.08; evalue=8.3e-137

ssCGmGCGss

SSCGCKCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3300 (20.95%)
Max nb of predicted sites per peak: 41
(chr17:68291304-68292017)
Mean nb of predicted sites per peak: 5.22

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=118.90; evalue=1.3e-119

ssCGGCCGss

SSCGGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3032 (19.25%)
Max nb of predicted sites per peak: 66
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 8.36

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=110.15; evalue=7.1e-111

ssCTGGGCAGGGCasg

CSTGCCCTGCCCAGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4370 (27.74%)
Max nb of predicted sites per peak: 24
(chr7:44324937-44325834)
Mean nb of predicted sites per peak: 2.83

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=105.65; evalue=2.2e-106

ssCGGAGCGss

SSCGCTCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3167 (20.11%)
Max nb of predicted sites per peak: 31
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 4.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=300; evalue=1e-300

csGCyGCyGCCrsCssCkCCGCss

SSGCGGMGSSGSYGGCRGCRGCSG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3812 (24.20%)
Max nb of predicted sites per peak: 201
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 15.90

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=300; evalue=1e-300

gctGCaGCaGCtGCGss

SSCGCAGCTGCTGCAGC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3786 (24.04%)
Max nb of predicted sites per peak: 89
(chrX:148500419-148501264)
Mean nb of predicted sites per peak: 6.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=300; evalue=1e-300

ssCCGCCCgGCGCGCyGCCvmGss

SSCKBGGCRGCGCGCCGGGCGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3431 (21.78%)
Max nb of predicted sites per peak: 316
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 24.28

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=300; evalue=1e-300

sssCcgCcCCGCCgCsCCCgCsss

SSSGCGGGSGCGGCGGGGCGGSSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3597 (22.84%)
Max nb of predicted sites per peak: 502
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 40.51

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=300; evalue=1e-300

ssGGCCAGGCCss

SSGGCCTGGCCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3674 (23.33%)
Max nb of predicted sites per peak: 33
(chr17:46771210-46772123)
Mean nb of predicted sites per peak: 3.23

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=106.67; evalue=2.1e-107

wwATTTTTAww

WWTAAAAATWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 6155 (39.08%)
Max nb of predicted sites per peak: 51
(chr9:34345590-34346446)
Mean nb of predicted sites per peak: 1.80

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=90.02; evalue=9.5e-91

ssCGCCCCCgss

SSCGGGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3978 (25.26%)
Max nb of predicted sites per peak: 90
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 8.49

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=73.61; evalue=2.5e-74

ssCGCCCtCgss

SSCGAGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3674 (23.33%)
Max nb of predicted sites per peak: 64
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 6.56

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=56.36; evalue=4.4e-57

ssCGGCtGCGss

SSCGCAGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3608 (22.91%)
Max nb of predicted sites per peak: 59
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 6.77

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=53.65; evalue=2.2e-54

ssCGGCCCGss

SSCGGGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3322 (21.09%)
Max nb of predicted sites per peak: 49
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 5.52

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=300; evalue=1e-300

ssCgCCCCgCCCgCgCsCgsCCss

SSGGSCGSGCGCGGGCGGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3515 (22.32%)
Max nb of predicted sites per peak: 498
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 40.62

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=300; evalue=1e-300

ssCGGCaGCCaGCCss

SSGGCTGGCTGCCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4184 (26.56%)
Max nb of predicted sites per peak: 72
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 5.20

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=300; evalue=1e-300

ssGsGGCGGcsGCGGCGssGGcss

SSGCCSSCGCCGCSGCCGCCSCSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3543 (22.49%)
Max nb of predicted sites per peak: 430
(chr20:63830894-63831789)
Mean nb of predicted sites per peak: 36.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=300; evalue=1e-300

srGGCTGGCCys

SRGGCCAGCCYS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2987 (18.96%)
Max nb of predicted sites per peak: 7
(chr7:138981052-138981940)
Mean nb of predicted sites per peak: 1.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=300; evalue=1e-300

ssaGGCaGCaGCtGCtGCCtss

SSAGGCAGCAGCTGCTGCCTSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2789 (17.71%)
Max nb of predicted sites per peak: 80
(chrX:148500419-148501264)
Mean nb of predicted sites per peak: 6.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: Asterocyte (05/01/2026 13:11)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results