peak-motifs oxLDL_CD4+_T_cell_chromatin

Motif discovery

Motif 1 oligos_6nt_test_vs_ctrl_m1

k-mer sig=350.00; evalue=0

wwTATTCAAww

WWTTGAATAWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTATTCAAww

POU2F3 MA0627.3 D 9 0.8182 0.734 0.600 NA NA

HLF MA0043.4 D 9 0.8182 0.733 0.600 NA NA

POU5F1B MA0792.1 D 9 0.8182 0.731 0.598 NA NA

Total matches= 14 (11 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1096 (7.04%)
Max nb of predicted sites per peak: 4
(chr12:89261186-89261702)
Mean nb of predicted sites per peak: 1.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_test_vs_ctrl_m2

k-mer sig=350.00; evalue=0

awATAaATGTGwr

YWCACATTTATWT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor awATAaATGTGwr

ZNF354A MA1978.2 D 13 0.6500 0.749 0.487 NA NA

Hmga1 MA2124.1 R 8 0.6154 0.751 0.462 NA NA

TBP MA0108.3 D 7 0.5385 0.849 0.457 NA NA

Total matches= 11 (8 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1455 (9.34%)
Max nb of predicted sites per peak: 42
(chr3:154310806-154311207)
Mean nb of predicted sites per peak: 1.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_test_vs_ctrl_m3

k-mer sig=350.00; evalue=0

wyACTTATwt

AWATAAGTRW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wyACTTATwt

Nkx3-1 MA0124.3 D 7 0.7000 0.859 0.602 NA NA

GATA2 MA0036.4 D 7 0.7000 0.851 0.596 NA NA

GATA4 MA0482.3 D 8 0.8000 0.710 0.568 NA NA

Total matches= 17 (14 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1691 (10.86%)
Max nb of predicted sites per peak: 4
(chr18:45723101-45723328)
Mean nb of predicted sites per peak: 1.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_test_vs_ctrl_m4

k-mer sig=350.00; evalue=0

tkAGTCATAwh

DWTATGACTMA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor tkAGTCATAwh

JUN::JUNB MA1132.2 R 8 0.7273 0.854 0.621 NA NA

FOSL1::JUND MA1142.2 R 8 0.7273 0.850 0.618 NA NA

FOS MA0476.2 D 8 0.7273 0.825 0.600 NA NA

Total matches= 37 (34 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1577 (10.13%)
Max nb of predicted sites per peak: 3
(chr9:104028985-104029316)
Mean nb of predicted sites per peak: 1.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_test_vs_ctrl_m5

k-mer sig=350.00; evalue=0

wwATGGTAAww

WWTTACCATWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwATGGTAAww

POU3F1 MA0786.2 D 10 0.9091 0.748 0.680 NA NA

POU3F2 MA0787.1 D 11 0.9167 0.735 0.674 NA NA

POU3F3 MA0788.1 D 11 0.8462 0.735 0.622 NA NA

Total matches= 28 (25 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 837 (5.38%)
Max nb of predicted sites per peak: 3
(chr8:100452778-100453207)
Mean nb of predicted sites per peak: 1.05

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_7nt_test_vs_ctrl_m1

k-mer sig=350.00; evalue=0

waaaCATtTTtAAAAtataww

WWTATATTTTAAAAATGTTTW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor waaaCATtTTtAAAAtataww

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1598 (10.26%)
Max nb of predicted sites per peak: 26
(chr7:138745982-138746497)
Mean nb of predicted sites per peak: 1.53

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_7nt_test_vs_ctrl_m2

k-mer sig=350.00; evalue=0

aaAAAAAmAAAAAaa

TTTTTTTKTTTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaAAAAAmAAAAAaa

Stat2 MA1623.2 D 10 0.6667 0.761 0.507 NA NA

ZNF384 MA1125.2 D 8 0.5333 0.942 0.502 NA NA

FOXE1 MA1487.3 D 10 0.5882 0.805 0.474 NA NA

Total matches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2629 (16.88%)
Max nb of predicted sites per peak: 44
(chr17:31926251-31926723)
Mean nb of predicted sites per peak: 5.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_7nt_test_vs_ctrl_m3

k-mer sig=350.00; evalue=0

dwtaTGAGTCAtaww

WWTATGACTCATAWH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor dwtaTGAGTCAtaww

BACH2 MA1101.3 R 11 0.7333 0.850 0.623 NA NA

NFE2 MA0841.2 R 10 0.6667 0.931 0.620 NA NA

JUNB MA0490.3 R 9 0.6000 0.999 0.599 NA NA

Total matches= 30 (27 more)

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2782 (17.87%)
Max nb of predicted sites per peak: 9
(chr4:72112654-72112802)
Mean nb of predicted sites per peak: 1.40

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_7nt_test_vs_ctrl_m4

k-mer sig=350.00; evalue=0

wwTaTaTTTTaaAAaattatww

WWATAATTTTTTAAAATATAWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTaTaTTTTaaAAaattatww

Total matches= 0

No match

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1647 (10.58%)
Max nb of predicted sites per peak: 40
(chr7:138745982-138746497)
Mean nb of predicted sites per peak: 1.99

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_7nt_test_vs_ctrl_m5

k-mer sig=350.00; evalue=0

aaAAAAAGAAAtGAAAtGaa

TTCATTTCATTTCTTTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaAAAAAGAAAtGAAAtGaa

Stat2 MA1623.2 D 10 0.5000 0.842 0.421 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2514 (16.14%)
Max nb of predicted sites per peak: 28
(chr17:31926251-31926723)
Mean nb of predicted sites per peak: 2.62

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus JASPAR2024_CORE_vertebrates_non-redundant database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: oxLDL_CD4+_T_cell_chromatin_accessibility (05/01/2026 15:12)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor waaaCATtTTtAAAAtataww

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTaTaTTTTaaAAaattatww

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaAAAAAGAAAtGAAAtGaa

Stat2 MA1623.2 D 10 0.5000 0.842 0.421 NA NA

Total matches= 1

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: oxLDL_CD4+_T_cell_chromatin_accessibility (05/01/2026 15:12)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor waaaCATtTTtAAAAtataww Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor wwTaTaTTTTaaAAaattatww Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor aaAAAAAGAAAtGAAAtGaa Stat2 MA1623.2 D 10 0.5000 0.842 0.421 NA NA Total matches= 1

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor waaaCATtTTtAAAAtataww

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwTaTaTTTTaaAAaattatww

Total matches= 0

JASPAR2024_CORE_vertebrates_non-redundant

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor aaAAAAAGAAAtGAAAtGaa

Stat2 MA1623.2 D 10 0.5000 0.842 0.421 NA NA

Total matches= 1