peak-motifs RAD21WT

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: cgcccccta (sig=80.76; e-value=1.7e-81)	RC: tagggggcg
oligos_6nt_mkv4_m2	assembly: ccactaga (sig=48.99; e-value=1e-49)	RC: tctagtgg
oligos_6nt_mkv4_m3	assembly: cgagcg (sig=35.43; e-value=3.7e-36)	RC: cgctcg
oligos_6nt_mkv4_m4	assembly: agagggca (sig=26.06; e-value=8.7e-27)	RC: tgccctct
oligos_6nt_mkv4_m5	assembly: tggcca (sig=24.00; e-value=1e-24)	RC: tggcca

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: ggcagcgccctctagtggcc (sig=300; e-value=1e-300)	RC: ggccactagagggcgctgcc
positions_6nt_m2	assembly: ctggtggcagcgccaccagg (sig=300; e-value=1e-300)	RC: cctggtggcgctgccaccag
positions_6nt_m3	assembly: ccagcagagggcgccctcta (sig=300; e-value=1e-300)	RC: tagagggcgccctctgctgg
positions_6nt_m4	assembly: taggtggcagcagagggcgc (sig=300; e-value=1e-300)	RC: gcgccctctgctgccaccta
positions_6nt_m5	assembly: cagggggcgctgccacctag (sig=300; e-value=1e-300)	RC: ctaggtggcagcgccccctg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: ctagagggcg (sig=44.65; e-value=2.2e-45)	RC: cgccctctag
oligos_7nt_mkv5_m2	assembly: cgccccctgc (sig=41.72; e-value=1.9e-42)	RC: gcagggggcg
oligos_7nt_mkv5_m3	assembly: cgccacct (sig=29.32; e-value=4.8e-30)	RC: aggtggcg
oligos_7nt_mkv5_m4	assembly: ggcagca (sig=26.34; e-value=4.6e-27)	RC: tgctgcc
oligos_7nt_mkv5_m5	assembly: accactag (sig=23.17; e-value=6.8e-24)	RC: ctagtggt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: gccagcaggtggcagcagag (sig=300; e-value=1e-300)	RC: ctctgctgccacctgctggc
positions_7nt_m2	assembly: cagcagagggcgccaccagg (sig=300; e-value=1e-300)	RC: cctggtggcgccctctgctg
positions_7nt_m3	assembly: ccagggggcgccccctggtg (sig=300; e-value=1e-300)	RC: caccagggggcgccccctgg
positions_7nt_m4	assembly: ctctgctgccctctagtggc (sig=300; e-value=1e-300)	RC: gccactagagggcagcagag
positions_7nt_m5	assembly: ggccactaggtggcagcagg (sig=300; e-value=1e-300)	RC: cctgctgccacctagtggcc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=80.76; evalue=1.7e-81

vsCGCCCCCTgsy

RSCAGGGGGCGSB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3462 (34.61%)
Max nb of predicted sites per peak: 10
(chr2:114737053-114737760)
Mean nb of predicted sites per peak: 1.29

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=48.99; evalue=1e-49

krCCACTAGAkg

CMTCTAGTGGYM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2764 (27.63%)
Max nb of predicted sites per peak: 4
(chrX:10087470-10087833)
Mean nb of predicted sites per peak: 1.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=35.43; evalue=3.7e-36

ssCGmGCGss

SSCGCKCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1344 (13.44%)
Max nb of predicted sites per peak: 19
(chr3:48722937-48723478)
Mean nb of predicted sites per peak: 2.59

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=26.06; evalue=8.7e-27

scAGAGGGCAsy

RSTGCCCTCTGS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2502 (25.01%)
Max nb of predicted sites per peak: 4
(chrX:10087470-10087833)
Mean nb of predicted sites per peak: 1.05

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=24.00; evalue=1e-24

bsTGGCCAsv

BSTGGCCASV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 873 (8.73%)
Max nb of predicted sites per peak: 14
(chr17:81153056-81153774)
Mean nb of predicted sites per peak: 2.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=300; evalue=1e-300

scgrcAGCGCCCYCTrGTGGCcrc

GYGGCCACYAGRGGGCGCTGYCGS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5524 (55.22%)
Max nb of predicted sites per peak: 9
(chr2:114737053-114737760)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=300; evalue=1e-300

ssctGGtGGCAGCGCCaCCaGgbg

CVCCTGGTGGCGCTGCCACCAGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1502 (15.02%)
Max nb of predicted sites per peak: 24
(chr10:80828555-80829311)
Mean nb of predicted sites per peak: 2.32

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=300; evalue=1e-300

ggCCAgCAGAGGGCGCcctckacy

RGTMGAGGGCGCCCTCTGCTGGCC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4260 (42.59%)
Max nb of predicted sites per peak: 9
(chr14:106465523-106466022)
Mean nb of predicted sites per peak: 1.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=300; evalue=1e-300

msyAGgkGsCAGCAGAGGGCgCys

SRGCGCCCTCTGCTGSCMCCTRSK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3041 (30.40%)
Max nb of predicted sites per peak: 9
(chr19:246771-247541)
Mean nb of predicted sites per peak: 1.26

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=300; evalue=1e-300

rscAGGgGGCGCTGCcaCCtmgys

SRCKAGGTGGCAGCGCCCCCTGSY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2071 (20.70%)
Max nb of predicted sites per peak: 17
(chr4:39979111-39979776)
Mean nb of predicted sites per peak: 1.80

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=44.65; evalue=2.2e-45

caCyAGAGGGCGcy

RGCGCCCTCTRGTG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 4870 (48.69%)
Max nb of predicted sites per peak: 10
(chr15:22461082-22461523)
Mean nb of predicted sites per peak: 1.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=41.72; evalue=1.9e-42

vsCGCCCCCTgcys

SRGCAGGGGGCGSB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3242 (32.41%)
Max nb of predicted sites per peak: 17
(chr10:101769289-101769959)
Mean nb of predicted sites per peak: 1.86

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=29.32; evalue=4.8e-30

rsCGCCACCTgs

SCAGGTGGCGSY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3301 (33.00%)
Max nb of predicted sites per peak: 8
(chr19:246771-247541)
Mean nb of predicted sites per peak: 1.18

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=26.34; evalue=4.6e-27

gbGGCAGCAsm

KSTGCTGCCVC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1738 (17.37%)
Max nb of predicted sites per peak: 9
(chr6:139694352-139694712)
Mean nb of predicted sites per peak: 1.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=23.17; evalue=6.8e-24

tgACCACTAGrk

MYCTAGTGGTCA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2151 (21.50%)
Max nb of predicted sites per peak: 11
(chr14:106465523-106466022)
Mean nb of predicted sites per peak: 1.09

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=300; evalue=1e-300

yggCCAscAGGkGGCAGCAgagvc

GBCTCTGCTGCCMCCTGSTGGCCR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5375 (53.73%)
Max nb of predicted sites per peak: 8
(chr7:948360-949009)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=300; evalue=1e-300

gcCAGCAGAGGGCGCCaccrgscs

SGSCYGGTGGCGCCCTCTGCTGGC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3506 (35.05%)
Max nb of predicted sites per peak: 9
(chr18:96665-97143)
Mean nb of predicted sites per peak: 1.22

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=300; evalue=1e-300

sgscmggggGCGCCCCCTGGTGgc

GCCACCAGGGGGCGCCCCCKGSCS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 3547 (35.46%)
Max nb of predicted sites per peak: 13
(chr19:1248936-1249245)
Mean nb of predicted sites per peak: 1.55

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=300; evalue=1e-300

gyctcTgCTGCCMYCTrGTGGccr

YGGCCACYAGRKGGCAGCAGAGRC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5724 (57.22%)
Max nb of predicted sites per peak: 6
(chr18:96665-97143)
Mean nb of predicted sites per peak: 1.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=300; evalue=1e-300

ryggCCACyAGGTGGCAGcAgrrs

SYYCTGCTGCCACCTRGTGGCCRY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 5522 (55.20%)
Max nb of predicted sites per peak: 6
(chr18:96665-97143)
Mean nb of predicted sites per peak: 1.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: RAD21WT (08/01/2026 11:11)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results