peak-motifs peak_enrichment

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: accttc (sig=6.37; e-value=4.3e-07)	RC: gaaggt
oligos_6nt_mkv4_m2	assembly: cttacc (sig=5.68; e-value=2.1e-06)	RC: ggtaag
oligos_6nt_mkv4_m3	assembly: accacc (sig=4.87; e-value=1.3e-05)	RC: ggtggt
oligos_6nt_mkv4_m4	assembly: ccttttc (sig=4.61; e-value=2.5e-05)	RC: gaaaagg
oligos_6nt_mkv4_m5	assembly: caaatc (sig=3.10; e-value=0.00079)	RC: gatttg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: aaataaaaagaaaaatataa (sig=36.36; e-value=4.4e-37)	RC: ttatatttttctttttattt
positions_6nt_m2	assembly: tgaaaataaaaagaaaaatt (sig=36.36; e-value=4.4e-37)	RC: aatttttctttttattttca
positions_6nt_m3	assembly: aaataaaaagaaaaaatata (sig=36.36; e-value=4.4e-37)	RC: tatattttttctttttattt
positions_6nt_m4	assembly: aaagaaaattgaaaaatata (sig=36.36; e-value=4.4e-37)	RC: tatatttttcaattttcttt
positions_6nt_m5	assembly: ataaaaagaagaaaaatata (sig=36.36; e-value=4.4e-37)	RC: tatatttttcttctttttat

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: caaaaac (sig=6.60; e-value=2.5e-07)	RC: gtttttg
oligos_7nt_mkv5_m2	assembly: cgtcttc (sig=6.58; e-value=2.6e-07)	RC: gaagacg
oligos_7nt_mkv5_m3	assembly: catcttc (sig=4.36; e-value=4.4e-05)	RC: gaagatg
oligos_7nt_mkv5_m4	assembly: cttcgtc (sig=3.44; e-value=0.00036)	RC: gacgaag
oligos_7nt_mkv5_m5	assembly: cttcatc (sig=3.44; e-value=0.00036)	RC: gatgaag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: aaaaaatat (sig=5.40; e-value=4e-06)	RC: atatttttt
positions_7nt_m2	assembly: aaaaaatt (sig=5.40; e-value=4e-06)	RC: aatttttt
positions_7nt_m3	assembly: agaagaa (sig=0.79; e-value=0.16)	RC: ttcttct
positions_7nt_m4	: (sig=; e-value=1)	RC:
positions_7nt_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

dyads

dyads_m1	assembly: tgaagaagag (sig=249.65; e-value=2.2e-250)	RC: ctcttcttca
dyads_m2	assembly: tgaagaagaaaa (sig=249.65; e-value=2.2e-250)	RC: ttttcttcttca
dyads_m3	assembly: caccacc (sig=161.69; e-value=2e-162)	RC: ggtggtg
dyads_m4	assembly: cagcagcagcagcagcag (sig=149.09; e-value=8.1e-150)	RC: ctgctgctgctgctgctg
dyads_m5	assembly: cagcagcagcaccagcag (sig=149.09; e-value=8.1e-150)	RC: ctgctggtgctgctgctg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=6.37; evalue=4.3e-07

vyACCTTCww

WWGAAGGTRB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 775 (23.41%)
Max nb of predicted sites per peak: 42
(chrIII:32198-33988)
Mean nb of predicted sites per peak: 3.56

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=5.68; evalue=2.1e-06

kyCtTACCrk

MYGGTAAGRM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 786 (23.74%)
Max nb of predicted sites per peak: 35
(chrVII:672799-675428)
Mean nb of predicted sites per peak: 3.51

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=4.87; evalue=1.3e-05

syACCACCrc

GYGGTGGTRS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 735 (22.20%)
Max nb of predicted sites per peak: 55
(chrXIII:671861-674420)
Mean nb of predicted sites per peak: 4.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=4.61; evalue=2.5e-05

ykCCTTTTCyt

ARGAAAAGGMR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 509 (15.37%)
Max nb of predicted sites per peak: 21
(chrVII:672799-675428)
Mean nb of predicted sites per peak: 2.70

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=3.10; evalue=0.00079

dyCAAATChw

WDGATTTGRH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 789 (23.83%)
Max nb of predicted sites per peak: 24
(chrII:420192-422535)
Mean nb of predicted sites per peak: 3.29

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=36.36; evalue=4.4e-37

aaaaatAaaaAgAAAaAtAtaaaa

TTTTATATTTTTCTTTTTATTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 644 (19.45%)
Max nb of predicted sites per peak: 220
(chrXIV:413739-416046)
Mean nb of predicted sites per peak: 8.62

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=36.36; evalue=4.4e-37

aawrAaAAtAaaaagAAAAAttaa

TTAATTTTTCTTTTTATTTTYWTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 621 (18.76%)
Max nb of predicted sites per peak: 200
(chrXIV:413739-416046)
Mean nb of predicted sites per peak: 6.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=36.36; evalue=4.4e-37

aaaaawaaaAArAAAAAAtataaa

TTTATATTTTTTYTTTTTWTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 615 (18.57%)
Max nb of predicted sites per peak: 228
(chrXIV:413739-416046)
Mean nb of predicted sites per peak: 8.30

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=36.36; evalue=4.4e-37

raaaaGaaaattGAAAAAtataaa

TTTATATTTTTCAATTTTCTTTTY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 555 (16.76%)
Max nb of predicted sites per peak: 68
(chrXIV:413739-416046)
Mean nb of predicted sites per peak: 3.88

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=36.36; evalue=4.4e-37

raataaaAaGAAGAAaAAtataaa

TTTATATTTTTCTTCTTTTTATTY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 669 (20.21%)
Max nb of predicted sites per peak: 188
(chrXIV:413739-416046)
Mean nb of predicted sites per peak: 6.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=6.60; evalue=2.5e-07

rmCAAaaACgd

HCGTTTTTGKY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 374 (11.30%)
Max nb of predicted sites per peak: 18
(chrIV:479179-481353)
Mean nb of predicted sites per peak: 2.72

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=6.58; evalue=2.6e-07

dtCGTCTTCwt

AWGAAGACGAH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 475 (14.35%)
Max nb of predicted sites per peak: 56
(chrXVI:252089-253580)
Mean nb of predicted sites per peak: 3.47

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=4.36; evalue=4.4e-05

wtCaTCTTCwt

AWGAAGATGAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 532 (16.07%)
Max nb of predicted sites per peak: 40
(chrXVI:252089-253580)
Mean nb of predicted sites per peak: 3.26

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=3.44; evalue=0.00036

wtCTTCGTCwt

AWGACGAAGAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 527 (15.92%)
Max nb of predicted sites per peak: 68
(chrXVI:252089-253580)
Mean nb of predicted sites per peak: 3.67

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=3.44; evalue=0.00036

wtCTTCaTCwt

AWGATGAAGAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 542 (16.37%)
Max nb of predicted sites per peak: 48
(chrXVI:252089-253580)
Mean nb of predicted sites per peak: 3.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=5.40; evalue=4e-06

rrAAAAAATATkm

KMATATTTTTTYY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 206 (6.22%)
Max nb of predicted sites per peak: 9
(chrIX:354872-356104)
Mean nb of predicted sites per peak: 1.99

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=5.40; evalue=4e-06

arAAAAAATtaw

WTAATTTTTTYT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 320 (9.66%)
Max nb of predicted sites per peak: 18
(chrIV:458680-460679)
Mean nb of predicted sites per peak: 2.57

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=0.79; evalue=0.16

gwAGAAGAAga

TCTTCTTCTWC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 749 (22.62%)
Max nb of predicted sites per peak: 60
(chrII:394113-397695)
Mean nb of predicted sites per peak: 3.87

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 dyads_m1

k-mer sig=249.65; evalue=2.2e-250

gatGAAGAAGAgga

TCCTCTTCTTCATC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 686 (20.72%)
Max nb of predicted sites per peak: 92
(chrXVI:252089-253580)
Mean nb of predicted sites per peak: 4.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 dyads_m2

k-mer sig=249.65; evalue=2.2e-250

ratGAAGAAGAaaaar

YTTTTTCTTCTTCATY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 664 (20.05%)
Max nb of predicted sites per peak: 112
(chrXVI:252089-253580)
Mean nb of predicted sites per peak: 4.83

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 21 dyads_m3

k-mer sig=161.69; evalue=2e-162

rcCACCACCas

STGGTGGTGGY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 420 (12.68%)
Max nb of predicted sites per peak: 25
(chrXIII:671861-674420)
Mean nb of predicted sites per peak: 3.58

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 22 dyads_m4

k-mer sig=149.09; evalue=8.1e-150

agCaGCaGCaGCaGCaGCaGca

TGCTGCTGCTGCTGCTGCTGCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 583 (17.61%)
Max nb of predicted sites per peak: 176
(chrII:462805-465351)
Mean nb of predicted sites per peak: 10.89

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 23 dyads_m5

k-mer sig=149.09; evalue=8.1e-150

agCaGCAGCaGCAsCAGCaGca

TGCTGCTGSTGCTGCTGCTGCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 602 (18.18%)
Max nb of predicted sites per peak: 148
(chrII:462805-465351)
Mean nb of predicted sites per peak: 9.82

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: peak_enrichment_YRA1 (20/01/2026 20:41)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results