peak-motifs peak_enrichment

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: accacc (sig=6.10; e-value=7.9e-07)	RC: ggtggt
oligos_6nt_mkv4_m2	assembly: accttc (sig=5.39; e-value=4.1e-06)	RC: gaaggt
oligos_6nt_mkv4_m3	assembly: tacata (sig=4.24; e-value=5.8e-05)	RC: tatgta
oligos_6nt_mkv4_m4	assembly: cttacc (sig=4.03; e-value=9.3e-05)	RC: ggtaag
oligos_6nt_mkv4_m5	assembly: ccttttc (sig=4.01; e-value=9.8e-05)	RC: gaaaagg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: taaaaaagaaaaattgaaaa (sig=53.15; e-value=7.1e-54)	RC: ttttcaatttttctttttta
positions_6nt_m2	assembly: taaaaaagaagaaaaattga (sig=53.15; e-value=7.1e-54)	RC: tcaatttttcttctttttta
positions_6nt_m3	assembly: aaataaaaaagaaaaatata (sig=53.15; e-value=7.1e-54)	RC: tatatttttcttttttattt
positions_6nt_m4	assembly: cttcaatttttcaaaaattg (sig=51.09; e-value=8.1e-52)	RC: caatttttgaaaaattgaag
positions_6nt_m5	assembly: caagaaaaattgaaaatata (sig=53.15; e-value=7.1e-54)	RC: tatattttcaatttttcttg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: caaaaac (sig=8.00; e-value=1e-08)	RC: gtttttg
oligos_7nt_mkv5_m2	assembly: cattttc (sig=7.18; e-value=6.6e-08)	RC: gaaaatg
oligos_7nt_mkv5_m3	assembly: ctttttc (sig=7.01; e-value=9.8e-08)	RC: gaaaaag
oligos_7nt_mkv5_m4	assembly: cgtcttc (sig=6.34; e-value=4.6e-07)	RC: gaagacg
oligos_7nt_mkv5_m5	assembly: catcttc (sig=5.81; e-value=1.5e-06)	RC: gaagatg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: aagaaaa (sig=3.34; e-value=0.00046)	RC: ttttctt
positions_7nt_m2	assembly: aaaaaat (sig=1.62; e-value=0.024)	RC: atttttt
positions_7nt_m3	: (sig=; e-value=1)	RC:
positions_7nt_m4	: (sig=; e-value=1)	RC:
positions_7nt_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

dyads

dyads_m1	assembly: tgaagaagag (sig=255.84; e-value=1.4e-256)	RC: ctcttcttca
dyads_m2	assembly: tgaagaagaaaa (sig=255.84; e-value=1.4e-256)	RC: ttttcttcttca
dyads_m3	assembly: caccacc (sig=165.35; e-value=4.5e-166)	RC: ggtggtg
dyads_m4	assembly: cagcagcagcagcagcag (sig=159.47; e-value=3.4e-160)	RC: ctgctgctgctgctgctg
dyads_m5	assembly: cagcagcagcaccagcag (sig=159.47; e-value=3.4e-160)	RC: ctgctggtgctgctgctg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=6.10; evalue=7.9e-07

syACCACCrc

GYGGTGGTRS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 779 (23.10%)
Max nb of predicted sites per peak: 143
(chrXIV:654759-660851)
Mean nb of predicted sites per peak: 4.84

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=5.39; evalue=4.1e-06

vyACCTTCkw

WMGAAGGTRB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 774 (22.95%)
Max nb of predicted sites per peak: 117
(chrXIV:654759-660851)
Mean nb of predicted sites per peak: 4.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=4.24; evalue=5.8e-05

yrTACATAya

TRTATGTAYR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 851 (25.23%)
Max nb of predicted sites per peak: 33
(chrIV:705385-709318)
Mean nb of predicted sites per peak: 3.14

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=4.03; evalue=9.3e-05

khCtTACCrk

MYGGTAAGDM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 796 (23.60%)
Max nb of predicted sites per peak: 65
(chrXIV:654759-660851)
Mean nb of predicted sites per peak: 3.85

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=4.01; evalue=9.8e-05

ddCCTTTTCyk

MRGAAAAGGHH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 524 (15.54%)
Max nb of predicted sites per peak: 30
(chrVII:629141-631216)
Mean nb of predicted sites per peak: 3.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=53.15; evalue=7.1e-54

aawAAaAAARAAAAattGaaaaaa

TTTTTTCAATTTTTYTTTTTTWTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 594 (17.61%)
Max nb of predicted sites per peak: 108
(chrVII:610908-614899)
Mean nb of predicted sites per peak: 6.77

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=53.15; evalue=7.1e-54

rrwaAAaAaGAAGAAaAAttgaaa

TTTCAATTTTTCTTCTTTTTTWYY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 635 (18.83%)
Max nb of predicted sites per peak: 90
(chrXII:459530-460839)
Mean nb of predicted sites per peak: 5.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=53.15; evalue=7.1e-54

aaaaawaAAAAArAAAAAtawaaa

TTTWTATTTTTYTTTTTTWTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 632 (18.74%)
Max nb of predicted sites per peak: 180
(chrVII:610908-614899)
Mean nb of predicted sites per peak: 9.07

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=51.09; evalue=8.1e-52

bkcttcaATtttTCaAaaattgkk

MMCAATTTTTGAAAAATTGAAGMV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 208 (6.17%)
Max nb of predicted sites per peak: 21
(chrXVI:292755-295906)
Mean nb of predicted sites per peak: 3.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=53.15; evalue=7.1e-54

hrCaAGAAAAAttGaaaatataaa

TTTATATTTTCAATTTTTCTTGYD

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 443 (13.13%)
Max nb of predicted sites per peak: 32
(chrXII:810375-815813)
Mean nb of predicted sites per peak: 2.71

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=8.00; evalue=1e-08

raCAAaaACgr

YCGTTTTTGTY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 341 (10.11%)
Max nb of predicted sites per peak: 32
(chrXII:810375-815813)
Mean nb of predicted sites per peak: 2.91

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=7.18; evalue=6.6e-08

wyCATttTCkt

AMGAAAATGRW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 530 (15.71%)
Max nb of predicted sites per peak: 65
(chrXIV:654759-660851)
Mean nb of predicted sites per peak: 3.55

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=7.01; evalue=9.8e-08

wwCTTtTTCkw

WMGAAAAAGWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 477 (14.14%)
Max nb of predicted sites per peak: 36
(chrXV:620335-624392)
Mean nb of predicted sites per peak: 3.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=6.34; evalue=4.6e-07

dtCGTCTTCwt

AWGAAGACGAH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 445 (13.19%)
Max nb of predicted sites per peak: 32
(chrXV:962209-966198)
Mean nb of predicted sites per peak: 3.21

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=5.81; evalue=1.5e-06

wtCaTCTTCwt

AWGAAGATGAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 540 (16.01%)
Max nb of predicted sites per peak: 65
(chrXIV:654759-660851)
Mean nb of predicted sites per peak: 3.57

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=3.34; evalue=0.00046

mrAAGAAAAwr

YWTTTTCTTYK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 996 (29.53%)
Max nb of predicted sites per peak: 70
(chrX:165688-171130)
Mean nb of predicted sites per peak: 4.17

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=1.62; evalue=0.024

aaAAAAAATam

KTATTTTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 847 (25.11%)
Max nb of predicted sites per peak: 30
(chrXIV:277300-279840)
Mean nb of predicted sites per peak: 3.10

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 dyads_m1

k-mer sig=255.84; evalue=1.4e-256

gmtGAaGAAGAgga

TCCTCTTCTTCAKC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 729 (21.61%)
Max nb of predicted sites per peak: 52
(chrIX:365385-368999)
Mean nb of predicted sites per peak: 4.53

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 dyads_m2

k-mer sig=255.84; evalue=1.4e-256

rmtGAAGAAGAAaaar

YTTTTTCTTCTTCAKY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 708 (20.99%)
Max nb of predicted sites per peak: 54
(chrXVI:252000-253427)
Mean nb of predicted sites per peak: 4.83

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 dyads_m3

k-mer sig=165.35; evalue=4.5e-166

abCACCACCas

STGGTGGTGVT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 422 (12.51%)
Max nb of predicted sites per peak: 45
(chrXVI:109445-114430)
Mean nb of predicted sites per peak: 3.79

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 21 dyads_m4

k-mer sig=159.47; evalue=3.4e-160

agCaGCaGCaGCaGCaGCaGca

TGCTGCTGCTGCTGCTGCTGCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 640 (18.97%)
Max nb of predicted sites per peak: 220
(chrII:462642-465133)
Mean nb of predicted sites per peak: 12.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 22 dyads_m5

k-mer sig=159.47; evalue=3.4e-160

arCaGCAGCAGCAsCaGCaGca

TGCTGCTGSTGCTGCTGCTGYT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 626 (18.56%)
Max nb of predicted sites per peak: 205
(chrII:462642-465133)
Mean nb of predicted sites per peak: 11.68

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: peak_enrichment_YRA1 (20/01/2026 21:01)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results