peak-motifs peak_enrichment

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: accacc (sig=5.03; e-value=9.3e-06)	RC: ggtggt
oligos_6nt_mkv4_m2	assembly: tacata (sig=3.29; e-value=0.00051)	RC: tatgta
oligos_6nt_mkv4_m3	assembly: aatatc (sig=3.23; e-value=0.00059)	RC: gatatt
oligos_6nt_mkv4_m4	assembly: accttc (sig=3.04; e-value=0.00091)	RC: gaaggt
oligos_6nt_mkv4_m5	assembly: gaaaac (sig=2.93; e-value=0.0012)	RC: gttttc

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: tcaaaaagaaaaaataaaaa (sig=56.74; e-value=1.8e-57)	RC: tttttattttttctttttga
positions_6nt_m2	assembly: gaaaataaaaagaaaaaatt (sig=56.74; e-value=1.8e-57)	RC: aattttttctttttattttc
positions_6nt_m3	assembly: ttttttatttttcaaaaata (sig=56.74; e-value=1.8e-57)	RC: tatttttgaaaaataaaaaa
positions_6nt_m4	assembly: aaataaaaagaaaaaatata (sig=56.74; e-value=1.8e-57)	RC: tatattttttctttttattt
positions_6nt_m5	assembly: caagaaaaataaaaaagaag (sig=56.74; e-value=1.8e-57)	RC: cttcttttttatttttcttg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: ctttttc (sig=7.04; e-value=9.1e-08)	RC: gaaaaag
oligos_7nt_mkv5_m2	assembly: cattttc (sig=6.46; e-value=3.5e-07)	RC: gaaaatg
oligos_7nt_mkv5_m3	assembly: catcttc (sig=5.08; e-value=8.3e-06)	RC: gaagatg
oligos_7nt_mkv5_m4	assembly: caaaaac (sig=5.08; e-value=8.3e-06)	RC: gtttttg
oligos_7nt_mkv5_m5	assembly: cgtcttc (sig=4.03; e-value=9.3e-05)	RC: gaagacg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: aaaagaaaaaaataaa (sig=11.93; e-value=1.2e-12)	RC: tttatttttttctttt
positions_7nt_m2	assembly: aaaagaaaaaaatttttttc (sig=11.93; e-value=1.2e-12)	RC: gaaaaaaatttttttctttt
positions_7nt_m3	assembly: tatatata (sig=0.20; e-value=0.63)	RC: tatatata
positions_7nt_m4	: (sig=; e-value=1)	RC:
positions_7nt_m5	: (sig=; e-value=1)	RC:

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

dyads

dyads_m1	assembly: tgaagaagag (sig=199.89; e-value=1.3e-200)	RC: ctcttcttca
dyads_m2	assembly: tgaagaagaaaa (sig=199.89; e-value=1.3e-200)	RC: ttttcttcttca
dyads_m3	assembly: caccacc (sig=129.08; e-value=8.3e-130)	RC: ggtggtg
dyads_m4	assembly: tcaccaac (sig=108.02; e-value=9.5e-109)	RC: gttggtga
dyads_m5	assembly: cagcagcagcagcagc (sig=106.05; e-value=8.9e-107)	RC: gctgctgctgctgctg

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=5.03; evalue=9.3e-06

syACCaCCrc

GYGGTGGTRS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 689 (21.80%)
Max nb of predicted sites per peak: 63
(chrXVI:110118-114397)
Mean nb of predicted sites per peak: 4.13

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=3.29; evalue=0.00051

yrTACATAya

TRTATGTAYR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 893 (28.26%)
Max nb of predicted sites per peak: 28
(chrIV:1308632-1311781)
Mean nb of predicted sites per peak: 2.91

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=3.23; evalue=0.00059

rvAATATCmy

RKGATATTBY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1000 (31.65%)
Max nb of predicted sites per peak: 60
(chrX:165712-171189)
Mean nb of predicted sites per peak: 4.47

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=3.04; evalue=0.00091

vyACCTTCkw

WMGAAGGTRB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 711 (22.50%)
Max nb of predicted sites per peak: 80
(chrX:165712-171189)
Mean nb of predicted sites per peak: 3.84

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=2.93; evalue=0.0012

wdGAAAACrr

YYGTTTTCHW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 865 (27.37%)
Max nb of predicted sites per peak: 48
(chrXI:40636-44613)
Mean nb of predicted sites per peak: 3.87

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=56.74; evalue=1.8e-57

aawmaaAAArAAAAAAwAAaAaaa

TTTTTTTWTTTTTTYTTTTTKWTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 546 (17.28%)
Max nb of predicted sites per peak: 148
(chrXII:121718-123658)
Mean nb of predicted sites per peak: 9.95

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=56.74; evalue=1.8e-57

aaraaAAtAAaaaRaAaAAattaa

TTAATTTTTTYTTTTTATTTTYTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 607 (19.21%)
Max nb of predicted sites per peak: 124
(chrXII:459555-460838)
Mean nb of predicted sites per peak: 6.81

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=56.74; evalue=1.8e-57

wyttttttaTttttCaaaaaTaww

WWTATTTTTGAAAAATAAAAAARW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 433 (13.70%)
Max nb of predicted sites per peak: 102
(chrM:6598-8272)
Mean nb of predicted sites per peak: 3.11

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=56.74; evalue=1.8e-57

aaAaAwaAAAarAAaAAawawaaa

TTTWTWTTTTTTYTTTTTWTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 616 (19.49%)
Max nb of predicted sites per peak: 136
(chrXII:459555-460838)
Mean nb of predicted sites per peak: 8.75

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=56.74; evalue=1.8e-57

aamAArAAAAAwAAaAAarAaraa

TTYTTYTTTTTTWTTTTTYTTKTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 585 (18.51%)
Max nb of predicted sites per peak: 128
(chrXII:121718-123658)
Mean nb of predicted sites per peak: 7.59

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=7.04; evalue=9.1e-08

wwCTTttTCkw

WMGAAAAAGWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 542 (17.15%)
Max nb of predicted sites per peak: 30
(chrXV:620904-624407)
Mean nb of predicted sites per peak: 2.99

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=6.46; evalue=3.5e-07

wyCATttTCkt

AMGAAAATGRW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 529 (16.74%)
Max nb of predicted sites per peak: 42
(chrXII:811113-815668)
Mean nb of predicted sites per peak: 3.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=5.08; evalue=8.3e-06

wtCatCTTCwt

AWGAAGATGAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 505 (15.98%)
Max nb of predicted sites per peak: 30
(chrIX:144362-147228)
Mean nb of predicted sites per peak: 3.33

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=5.08; evalue=8.3e-06

waCAAaaACkr

YMGTTTTTGTW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 325 (10.28%)
Max nb of predicted sites per peak: 28
(chrXII:811113-815668)
Mean nb of predicted sites per peak: 2.81

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=4.03; evalue=9.3e-05

wtCGTCTTCwt

AWGAAGACGAW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 422 (13.35%)
Max nb of predicted sites per peak: 45
(chrXI:576319-577052)
Mean nb of predicted sites per peak: 3.09

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=11.93; evalue=1.2e-12

aaaaaarAAAAAAAtaaaaa

TTTTTATTTTTTTYTTTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 661 (20.92%)
Max nb of predicted sites per peak: 134
(chrXII:459555-460838)
Mean nb of predicted sites per peak: 7.36

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=11.93; evalue=1.2e-12

waaaaaGAaaAaaatttttTtcww

WWGAAAAAAATTTTTTTCTTTTTW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 294 (9.30%)
Max nb of predicted sites per peak: 30
(chrM:6598-8272)
Mean nb of predicted sites per peak: 3.32

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=0.20; evalue=0.63

taTATATATAta

TATATATATATA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 350 (11.08%)
Max nb of predicted sites per peak: 112
(chrXI:40636-44613)
Mean nb of predicted sites per peak: 10.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 dyads_m1

k-mer sig=199.89; evalue=1.3e-200

gmtGAaGAaGAgga

TCCTCTTCTTCAKC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 661 (20.92%)
Max nb of predicted sites per peak: 66
(chrXI:250344-253792)
Mean nb of predicted sites per peak: 4.64

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 dyads_m2

k-mer sig=199.89; evalue=1.3e-200

ratGAAGAaGAAaaar

YTTTTTCTTCTTCATY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 661 (20.92%)
Max nb of predicted sites per peak: 57
(chrII:204042-206124)
Mean nb of predicted sites per peak: 4.65

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 21 dyads_m3

k-mer sig=129.08; evalue=8.3e-130

asCACCACCas

STGGTGGTGST

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 337 (10.66%)
Max nb of predicted sites per peak: 42
(chrXVI:110118-114397)
Mean nb of predicted sites per peak: 3.25

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 22 dyads_m4

k-mer sig=108.02; evalue=9.5e-109

ctTCACCAACat

ATGTTGGTGAAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 432 (13.67%)
Max nb of predicted sites per peak: 112
(chrIV:205516-209427)
Mean nb of predicted sites per peak: 3.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 23 dyads_m5

k-mer sig=106.05; evalue=8.9e-107

arCaGCaGCaGCaGCaGCar

YTGCTGCTGCTGCTGCTGYT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 588 (18.61%)
Max nb of predicted sites per peak: 148
(chrII:462571-464847)
Mean nb of predicted sites per peak: 9.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: peak_enrichment_YRA1 (20/01/2026 21:19)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results