peak-motifs 3UTR

Motif discovery

Motif 1 oligos_6nt_mkv3_m1

k-mer sig=89.41; evalue=3.9e-90

arGAAtAAAaav

BTTTTTATTCYT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 152 (1.12%)
Max nb of predicted sites per peak: 2
(M5460:10;+;14694311)
Mean nb of predicted sites per peak: 1.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv3_m2

k-mer sig=89.41; evalue=3.9e-90

mraAATAAAaar

YTTTTTATTTYK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 232 (1.70%)
Max nb of predicted sites per peak: 3
(M31392:8;+;2011643)
Mean nb of predicted sites per peak: 1.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv3_m3

k-mer sig=10.58; evalue=2.6e-11

arvaAAAGAAAArr

YYTTTTCTTTTBYT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 321 (2.36%)
Max nb of predicted sites per peak: 30
(M13184:2;-;2372103)
Mean nb of predicted sites per peak: 1.74

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv3_m4

k-mer sig=10.26; evalue=5.5e-11

wamttAAttAAthm

KDATTAATTAAKTW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 74 (0.54%)
Max nb of predicted sites per peak: 4
(M29807:7;+;26404690)
Mean nb of predicted sites per peak: 1.16

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv3_m5

k-mer sig=89.41; evalue=3.9e-90

awmAATAAAaav

BTTTTTATTKWT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 167 (1.23%)
Max nb of predicted sites per peak: 2
(M28611:6;-;31204039)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 oligos_6nt_mkv3_m6

k-mer sig=9.59; evalue=2.6e-10

mwGtatGtAACArm

KYTGTTACATACWK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 72 (0.53%)
Max nb of predicted sites per peak: 1
(M9916:12;+;27393727)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 oligos_6nt_mkv3_m7

k-mer sig=9.42; evalue=3.8e-10

mvgAAtGAAmm

KKTTCATTCBK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 73 (0.54%)
Max nb of predicted sites per peak: 1
(M9978:12;-;559282)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 oligos_6nt_mkv3_m8

k-mer sig=8.34; evalue=4.6e-09

aastACtAStAStAGtacyw

WRGTACTASTASTAGTASTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 94 (0.69%)
Max nb of predicted sites per peak: 5
(M12269:2;+;25671513)
Mean nb of predicted sites per peak: 1.48

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 oligos_6nt_mkv3_m9

k-mer sig=8.18; evalue=6.6e-09

mwrtATATAtrya

TRYATATATAYWK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 284 (2.08%)
Max nb of predicted sites per peak: 10
(M24854:5;-;13840605)
Mean nb of predicted sites per peak: 1.46

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 oligos_6nt_mkv3_m10

k-mer sig=23.28; evalue=5.2e-24

arGAAtAAGra

TYCTTATTCYT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 88 (0.65%)
Max nb of predicted sites per peak: 1
(M9185:12;+;5174478)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 positions_6nt_m1

k-mer sig=41.37; evalue=4.3e-42

tcatatGtACtGtatAtACagtwc

GWACTGTATATACAGTACATATGA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 45 (0.33%)
Max nb of predicted sites per peak: 2
(M17560:3;-;1787670)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 positions_6nt_m2

k-mer sig=41.37; evalue=4.3e-42

ymrCtRkAtGtAtatACAGyaCwm

KWGTRCTGTATATACATMYAGYKR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 57 (0.42%)
Max nb of predicted sites per peak: 2
(M24854:5;-;13840605)
Mean nb of predicted sites per peak: 1.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 positions_6nt_m3

k-mer sig=41.37; evalue=4.3e-42

ymtRtAtAtrtACAtAtACaGtyv

BRACTGTATATGTAYATATAYAKR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 77 (0.57%)
Max nb of predicted sites per peak: 7
(M24854:5;-;13840605)
Mean nb of predicted sites per peak: 1.45

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 positions_6nt_m4

k-mer sig=27.08; evalue=8.3e-28

amAAaGAAaaaattttttCtttyt

ARAAAGAAAAAATTTTTTCTTTKT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 97 (0.71%)
Max nb of predicted sites per peak: 6
(M18325:3;-;11710881)
Mean nb of predicted sites per peak: 1.28

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 positions_6nt_m5

k-mer sig=22.21; evalue=6.2e-23

yyGtGtGtAAAya

TRTTTACACACRR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 60 (0.44%)
Max nb of predicted sites per peak: 2
(M8844:11;-;27116590)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_6nt_m6

k-mer sig=41.37; evalue=4.3e-42

hmtGtaCtGtAtatatGtAtGtmy

RKACATACATATATACAGTACAKD

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 59 (0.43%)
Max nb of predicted sites per peak: 3
(M129:1;+;1605730)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_6nt_m7

k-mer sig=37.17; evalue=6.8e-38

dmtGtGtaatACAGtACAtAtabr

YVTATATGTACTGTATTACACAKH

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 35 (0.26%)
Max nb of predicted sites per peak: 1
(M7526:11;+;16279660)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_6nt_m8

k-mer sig=41.37; evalue=4.3e-42

kasttGtAtatACAGtaCatatdh

DHATATGTACTGTATATACAASTM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 39 (0.29%)
Max nb of predicted sites per peak: 1
(M7055:11;+;694256)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_6nt_m9

k-mer sig=41.37; evalue=4.3e-42

ryCAtGtACtGtAtatGtaaaky

RMTTTACATATACAGTACATGRY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 56 (0.41%)
Max nb of predicted sites per peak: 1
(M8557:11;-;16917677)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_6nt_m10

k-mer sig=21.58; evalue=2.6e-22

yytCttttttCtttyy

RRAAAGAAAAAAGARR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 118 (0.87%)
Max nb of predicted sites per peak: 5
(M3156:1;-;9379086)
Mean nb of predicted sites per peak: 1.56

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 21 oligos_7nt_mkv4_m1

k-mer sig=10.75; evalue=1.8e-11

mrGAAtAAAAtsmr

YKSATTTTATTCYK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 137 (1.01%)
Max nb of predicted sites per peak: 2
(M5460:10;+;14694311)
Mean nb of predicted sites per peak: 1.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 22 oligos_7nt_mkv4_m2

k-mer sig=5.46; evalue=3.5e-06

avwGAAtGAAAar

YTTTTCATTCWBT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 73 (0.54%)
Max nb of predicted sites per peak: 2
(M8290:11;-;5378624)
Mean nb of predicted sites per peak: 1.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 23 oligos_7nt_mkv4_m3

k-mer sig=5.29; evalue=5.1e-06

rvAAAAGAAAArr

YYTTTTCTTTTBY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 321 (2.36%)
Max nb of predicted sites per peak: 30
(M13184:2;-;2372103)
Mean nb of predicted sites per peak: 1.70

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 24 oligos_7nt_mkv4_m4

k-mer sig=5.29; evalue=5.1e-06

yyttTtCtTttyy

RRAAAAGAAAARR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 145 (1.06%)
Max nb of predicted sites per peak: 6
(M3156:1;-;9379086)
Mean nb of predicted sites per peak: 1.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 25 oligos_7nt_mkv4_m5

k-mer sig=3.88; evalue=0.00013

wrattAAttAAtym

KRATTAATTAATYW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 75 (0.55%)
Max nb of predicted sites per peak: 4
(M6498:10;-;15402609)
Mean nb of predicted sites per peak: 1.24

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 26 oligos_7nt_mkv4_m6

k-mer sig=7.83; evalue=1.5e-08

mdGAAtAAAGmr

YKCTTTATTCHK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 111 (0.81%)
Max nb of predicted sites per peak: 2
(M8749:11;-;23194895)
Mean nb of predicted sites per peak: 1.03

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 27 oligos_7nt_mkv4_m7

k-mer sig=2.35; evalue=0.0045

maGtACAtAym

KRTATGTACTK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 123 (0.90%)
Max nb of predicted sites per peak: 2
(M27801:6;-;11737178)
Mean nb of predicted sites per peak: 1.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 28 oligos_7nt_mkv4_m8

k-mer sig=1.96; evalue=0.011

vcAGtTTtGhr

YDCAAAACTGB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 160 (1.17%)
Max nb of predicted sites per peak: 2
(M6647:10;-;18857950)
Mean nb of predicted sites per peak: 1.01

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 29 oligos_7nt_mkv4_m9

k-mer sig=1.76; evalue=0.017

avtACtAGtAcw

WGTACTAGTABT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 177 (1.30%)
Max nb of predicted sites per peak: 3
(M6994:10;-;23079471)
Mean nb of predicted sites per peak: 1.17

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 30 oligos_7nt_mkv4_m10

k-mer sig=1.60; evalue=0.025

ytTATTTATby

RVATAAATAAR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 182 (1.34%)
Max nb of predicted sites per peak: 3
(M6578:10;-;17773250)
Mean nb of predicted sites per peak: 1.06

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 31 positions_7nt_m1

k-mer sig=19.63; evalue=2.3e-20

ryrtAtAtrtAtAtAyAtAtAyry

RYRTATATRTATATAYATATAYRY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 79 (0.58%)
Max nb of predicted sites per peak: 9
(M17417:3;+;36319619)
Mean nb of predicted sites per peak: 2.70

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 32 positions_7nt_m2

k-mer sig=19.63; evalue=2.3e-20

mtrtatAtrtAtAtAtAyAtatry

RYATATRTATATATAYATATAYAK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 87 (0.64%)
Max nb of predicted sites per peak: 10
(M10084:12;-;1807678)
Mean nb of predicted sites per peak: 2.61

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 33 positions_7nt_m3

k-mer sig=11.75; evalue=1.8e-12

yytttCtttttttYttyy

RRAARAAAAAAAGAAARR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 114 (0.84%)
Max nb of predicted sites per peak: 8
(M1512:1;+;29488165)
Mean nb of predicted sites per peak: 1.91

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 34 positions_7nt_m4

k-mer sig=19.63; evalue=2.3e-20

ryatrtAtrtAtAtAyAtAtAyay

RTRTATATRTATATAYATAYATRY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 79 (0.58%)
Max nb of predicted sites per peak: 9
(M24854:5;-;13840605)
Mean nb of predicted sites per peak: 2.63

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 35 positions_7nt_m5

k-mer sig=19.63; evalue=2.3e-20

mmataCtGtaCAtatACAtACaym

KRTGTATGTATATGTACAGTATKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 75 (0.55%)
Max nb of predicted sites per peak: 4
(M12741:2;+;32167817)
Mean nb of predicted sites per peak: 1.21

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 36 positions_7nt_m6

k-mer sig=10.13; evalue=7.4e-11

yrtatACtGtACtGwa

TWCAGTACAGTATAYR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 91 (0.67%)
Max nb of predicted sites per peak: 2
(M7308:11;+;5948117)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 37 positions_7nt_m7

k-mer sig=19.63; evalue=2.3e-20

mctgttGtAtATAYAtAtAYay

RTRTATATRTATATACAACAGK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 82 (0.60%)
Max nb of predicted sites per peak: 7
(M24854:5;-;13840605)
Mean nb of predicted sites per peak: 1.82

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 38 positions_7nt_m8

k-mer sig=11.75; evalue=1.8e-12

aaAAgAAaaAaatttttTtCtttt

AAAAGAAAAAAATTTTTTTCTTTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 68 (0.50%)
Max nb of predicted sites per peak: 5
(M18325:3;-;11710881)
Mean nb of predicted sites per peak: 1.47

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 39 positions_7nt_m9

k-mer sig=19.63; evalue=2.3e-20

aymtRtAtAtAYAtAtAYay

RTRTATATRTATATAYAKRT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 122 (0.90%)
Max nb of predicted sites per peak: 8
(M24854:5;-;13840605)
Mean nb of predicted sites per peak: 1.88

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 40 positions_7nt_m10

k-mer sig=7.64; evalue=2.3e-08

rsAtGtGtAAtAha

TDTATTACACATSY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 56 (0.41%)
Max nb of predicted sites per peak: 1
(M9727:12;+;23502362)
Mean nb of predicted sites per peak: 1.00

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: 3UTR_NUE (09/04/2026 08:26)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results