; variation-scan -v 1 -m $RSAT/public_html/tmp/www-data/2026/06/05/variation-scan_2026-06-05.073312_ApJ5UXvariation-scan_sequence_custom_motif_manualinput.tf -m_format transfac -i $RSAT/public_html/tmp/www-data/2026/06/05/variation-scan_2026-06-05.073312_ApJ5UX_variation-scan_sequence_input.txt -bg $RSAT/public_html/data/genomes/Hordeum_vulgare.MorexV3_pseudomolecules_assembly.60/oligo-frequencies/2nt_upstream-noorf_Hordeum_vulgare.MorexV3_pseudomolecules_assembly.60-ovlp-1str.freq.gz -lth score 1 -lth w_diff 1 -lth pval_ratio 10 -uth pval 1e-3
; Input file
; 	$RSAT/public_html/tmp/www-data/2026/06/05/variation-scan_2026-06-05.073312_ApJ5UX_variation-scan_sequence_input.txt
;	column content
;	1	matrix_ac	Accession number of the positions-pecific scoring matrix
;	2	var_id	ID of the variation
;	3	var_class	Variation type, according to SNP Ontology (SO) nomenclature
;	4	var_coord	Coordinates of the variation
;	5	best_w	Best weight for the putative site
;	6	worst_w	Worst weight for the putative site
;	7	w_diff	Difference between best and worst weight
;	8	best_pval	P_value of the best putative site
;	9	worst_pval	P_value of the worst putative site
;	10	pval_ratio	Ratio between worst and best pval ( pval_ratio = worst_pval/best_pval )
;	11	best_variant	Variant in the best putative site
;	12	worst_variant	Variant in the worst putative site
;	13	best_offest	Offset of the best putative site
;	14	worst_offset	Offset of the worst putative site
;	15	min_offset_diff	Difference minimal between best and worst putative site
;	16	best_strand	Strand of the best putative site
;	17	worst_strand	Strand of the worst putative site
;	18	str_change	Indicate if strand has changed between the offset of min_offset_diff
;	19	best_seq	Sequence of the worst putative site
;	20	worst_seq	Sequence of the worst putative site
;	21	minor_alle_freq	Minor allele frequency
#ac_motif	var_id	var_class	var_coord	best_w	worst_w	w_diff	best_pval	worst_pval	pval_ratio	best_variant	worst_variant	best_offset	worst_offset	min_offset_diff	best_strand	worst_strand	str_change	best_seq	worst_seq	minor_allele_freq
AY750993_VRN1_EEADannot	vcZ23GVBC	SNV	1H:28647975-28647976_+	7.58	3.71	3.87	6.40e-05	3.10e-03	48.44	G	A	-9	-9	0	R	R	0	CGAAAAAAGG	TGAAAAAAGG	NA
AY750993_VRN1_EEADannot	vcZ0CGKQ	SNV	1H:522795357-522795358_+	7.00	3.74	3.26	1.30e-04	3.10e-03	23.85	T	G	-5	-5	0	R	R	0	CCAAAACTGG	CCAACACTGG	NA
AY750993_VRN1_EEADannot	vcZ0CGKQ	SNV	1H:522795357-522795358_+	7.00	3.74	3.26	1.30e-04	3.10e-03	23.85	T	G	-5	-5	0	R	R	0	CCAAAACTGG	CCAACACTGG	NA
AY750993_VRN1_EEADannot	vcZ5Z7CV	SNV	2H:624110307-624110308_+	6.05	3.19	2.86	4.30e-04	4.50e-03	10.47	A	G	-4	-4	0	D	D	0	CCTGAACAGG	CCTGGACAGG	NA
AY750993_VRN1_EEADannot	vcZ0PU2Q	SNV	3H:621608504-621608505_+	5.44	1.59	3.85	7.30e-04	1.20e-02	16.44	G	A	-9	-9	0	R	R	0	CTCAATAAGG	TTCAATAAGG	NA
AY750993_VRN1_EEADannot	vcZ399WA	SNV	3H:694191868-694191869_+	5.52	-0.39	5.91	6.80e-04	3.40e-02	50.00	G	T	-8	-8	0	D	D	0	CCAAGTAAGG	CCAAGTAATG	NA
AY750993_VRN1_EEADannot	vcZ14SAD	deletion	4H:27048334-27048347_+	5.51	1.85	3.66	6.80e-04	1.10e-02	16.18	CTGT	CTGTCGACTTAGT	-1	8	9	R	R	0	CAAAAACAGG	CAAAAACTAA	NA
AY750993_VRN1_EEADannot	vcZ5NH8K	SNV	4H:636466513-636466514_+	5.79	0.22	5.57	5.30e-04	2.60e-02	49.06	C	G	-1	-1	0	R	R	0	CAAGAAAGGG	CAAGAAAGCG	NA
AY750993_VRN1_EEADannot	vcZ5NH8K	SNV	4H:636466513-636466514_+	5.68	-0.21	5.89	5.90e-04	3.10e-02	52.54	C	G	0	0	0	R	R	0	ACAAGAAAGG	ACAAGAAAGC	NA
AY750993_VRN1_EEADannot	vcZ24QIBV	SNV	5H:560322727-560322728_+	9.57	7.85	1.71	2.50e-06	4.70e-05	18.80	A	C	-3	-3	0	D	D	0	CCAAAAAAGG	CCACAAAAGG	NA
AY750993_VRN1_EEADannot	vcZ20BRW	SNV	6H:515294844-515294845_+	5.08	1.54	3.55	9.80e-04	1.30e-02	13.27	G	A	-9	-9	0	R	R	0	CCATAGAAGG	TCATAGAAGG	NA
AY750993_VRN1_EEADannot	vcZ3DJRB	SNV	6H:560060287-560060288_+	8.84	7.35	1.49	8.00e-06	9.00e-05	11.25	G	A	-8	-8	0	R	R	0	CCAGAAATGG	CTAGAAATGG	NA
AY750993_VRN1_EEADannot	vcZ11NTA	SNV	7H:100374102-100374103_+	7.15	1.78	5.36	1.10e-04	1.10e-02	100.00	T	A	-5	-5	0	R	R	0	CCCGAAAAAG	CCCGTAAAAG	NA
AY750993_VRN1_EEADannot	vcZ1GUFF	insertion	7H:588385081-588385087_+	8.23	-2.36	10.59	2.20e-05	7.70e-02	3500.00	GACCATTCCTTCCTTTTCTGTCCAT	GACCAT	11	2	9	R	R	0	ACAGAAAAGG	TTCCAGATGG	NA
; Host name	rsat
; Job started	2026-06-05.073312
; Job done	2026-06-05.073313
; Seconds	1.00
;	user	0.39
;	system	0.01
;	cuser	0.65
;	csystem	0.08