peak-motifs D1/regulonD1.rm.fna

Sequence composition (test sequences)

Nb of peaks: 1976
Total seq. size: 1254 kb
Min length: 201 bp
Mean length: 634.859 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Sequence composition (ctrl sequences)

Nb of peaks: 34310
Total seq. size: 22214 kb
Min length: 201 bp
Mean length: 647.449 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Motif discovery

Motif 1 oligos_5-7nt_m1oligos_5-7nt_m1

k-mer sig=45.89; evalue=1.3e-46

yCkTTksGCyCAAAmAwAArACmy

RKGTYTTWTKTTTGRGCSMAAMGR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yCkTTksGCyCAAAmAwAArACmy

Total matches= 0

No match

Motif 2 oligos_5-7nt_m2oligos_5-7nt_m2

k-mer sig=43.85; evalue=1.4e-44

GATCAAACACCCTAGGGTTTGCCC

GGGCAAACCCTAGGGTGTTTGATC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GATCAAACACCCTAGGGTTTGCCC

Total matches= 0

No match

Motif 3 oligos_5-7nt_m3oligos_5-7nt_m3

k-mer sig=45.89; evalue=1.3e-46

wkmrCCCArAwmsAAAACCCTArm

KYTAGGGTTTTSKWTYTGGGYKMW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wkmrCCCArAwmsAAAACCCTArm

TBP3.ampDAP:M0621:AthalianaCistrome TBP3.ampDAP/M0621/AthalianaCistrome R 17 0.6538 0.810 0.530 NA NA

TRP2:MA1356.1:JASPAR TRP2/MA1356.1/JASPAR D 17 0.6296 0.759 0.478 NA NA

TRP2:M09352:TRANSFAC TRP2/M09352/TRANSFAC D 17 0.6296 0.758 0.477 NA NA

Total matches= 12 (9 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 4 oligos_5-7nt_m4oligos_5-7nt_m4

k-mer sig=43.85; evalue=1.4e-44

syayCyaAAACyCtcCGcCGcyc

GRGCGGCGGAGRGTTTTRGRTRS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor syayCyaAAACyCtcCGcCGcyc

ESE3.ampDAP:M0061:AthalianaCistrome ESE3.ampDAP/M0061/AthalianaCistrome R 14 0.5833 0.711 0.415 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Motif 5 oligos_5-7nt_m5oligos_5-7nt_m5

k-mer sig=45.89; evalue=1.3e-46

vkhTkymkTTTkCKGGCChAAAym

KRTTTDGGCCMGMAAAMKRMADMB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor vkhTkymkTTTkCKGGCChAAAym

DEL2.ampDAP:M0366:AthalianaCistrome DEL2.ampDAP/M0366/AthalianaCistrome R 15 0.6250 0.738 0.461 NA NA

DEL1.ampDAP:M0365:AthalianaCistrome DEL1.ampDAP/M0365/AthalianaCistrome R 15 0.6250 0.735 0.459 NA NA

DEL2.DAP:M0363:AthalianaCistrome DEL2.DAP/M0363/AthalianaCistrome R 16 0.5714 0.718 0.410 NA NA

Total matches= 6 (3 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 6 dyads_test_vs_ctrl_m1dyads_test_vs_ctrl_m1

k-mer sig=55.85; evalue=1.4e-56

ssmaAAACCCTAGcy

RGCTAGGGTTTTKSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssmaAAACCCTAGcy

AT1G72740:M09328:TRANSFAC AT1G72740/M09328/TRANSFAC D 14 0.8750 0.848 0.742 NA NA

AT1G72740:MA1353.1:JASPAR AT1G72740/MA1353.1/JASPAR D 14 0.8750 0.847 0.741 NA NA

TBP3.ampDAP:M0621:AthalianaCistrome TBP3.ampDAP/M0621/AthalianaCistrome R 15 0.7895 0.785 0.620 NA NA

Total matches= 22 (19 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 7 dyads_test_vs_ctrl_m2dyads_test_vs_ctrl_m2

k-mer sig=49.74; evalue=1.8e-50

swCCCcCCCCCyGGCCCATct

AGATGGGCCRGGGGGGGGGWS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor swCCCcCCCCCyGGCCCATct

Total matches= 0

No match

Motif 8 dyads_test_vs_ctrl_m3dyads_test_vs_ctrl_m3

k-mer sig=31.24; evalue=5.8e-32

vrAAAAGCCCATsw

WSATGGGCTTTTYB

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor vrAAAAGCCCATsw

Dof3:M00354:TRANSFAC Dof3/M00354/TRANSFAC D 10 0.6667 0.775 0.517 NA NA

PHYPADRAFT_38837:M08125:TRANSFAC PHYPADRAFT_38837/M08125/TRANSFAC D 10 0.7143 0.709 0.506 NA NA

Dof1:M00352:TRANSFAC Dof1/M00352/TRANSFAC D 10 0.6667 0.757 0.505 NA NA

Total matches= 20 (17 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 9 dyads_test_vs_ctrl_m4dyads_test_vs_ctrl_m4

k-mer sig=55.85; evalue=1.4e-56

ssCCCdsssscsssGGsCCCgCCCss

SSGGGCGGGSCCSSSGSSSSHGGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCCCdsssscsssGGsCCCgCCCss

Total matches= 0

No match

Motif 10 dyads_test_vs_ctrl_m5dyads_test_vs_ctrl_m5

k-mer sig=55.85; evalue=1.4e-56

ssCCCdsssscgssGGsCCCGss

SSCGGGSCCSSCGSSSSHGGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCCCdsssscgssGGsCCCGss

Total matches= 0

No match

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus footDB database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J. (2012). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Res 40(4): e31.
Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012). A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets using peak-motifs. Nat Protoc 7(8): 1551-1568.

RSAT - peak-motifs result

Analysis: D1/regulonD1.rm.fna (25/02/2021 19:23)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yCkTTksGCyCAAAmAwAArACmy

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GATCAAACACCCTAGGGTTTGCCC

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor syayCyaAAACyCtcCGcCGcyc

ESE3.ampDAP:M0061:AthalianaCistrome ESE3.ampDAP/M0061/AthalianaCistrome R 14 0.5833 0.711 0.415 NA NA

Total matches= 1

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor swCCCcCCCCCyGGCCCATct

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCCCdsssscsssGGsCCCgCCCss

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCCCdsssscgssGGsCCCGss

Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: D1/regulonD1.rm.fna (25/02/2021 19:23)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor yCkTTksGCyCAAAmAwAArACmy Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor GATCAAACACCCTAGGGTTTGCCC Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor syayCyaAAACyCtcCGcCGcyc ESE3.ampDAP:M0061:AthalianaCistrome ESE3.ampDAP/M0061/AthalianaCistrome R 14 0.5833 0.711 0.415 NA NA Total matches= 1

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor swCCCcCCCCCyGGCCCATct Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ssCCCdsssscsssGGsCCCgCCCss Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ssCCCdsssscgssGGsCCCGss Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yCkTTksGCyCAAAmAwAArACmy

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GATCAAACACCCTAGGGTTTGCCC

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor syayCyaAAACyCtcCGcCGcyc

ESE3.ampDAP:M0061:AthalianaCistrome ESE3.ampDAP/M0061/AthalianaCistrome R 14 0.5833 0.711 0.415 NA NA

Total matches= 1

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor swCCCcCCCCCyGGCCCATct

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCCCdsssscsssGGsCCCgCCCss

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCCCdsssscgssGGsCCCGss

Total matches= 0