peak-motifs D5/regulonD5.rm.fna

Sequence composition (test sequences)

Nb of peaks: 169
Total seq. size: 107 kb
Min length: 201 bp
Mean length: 635.822 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Sequence composition (ctrl sequences)

Nb of peaks: 34310
Total seq. size: 22214 kb
Min length: 201 bp
Mean length: 647.449 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Motif discovery

Motif 1 oligos_5-7nt_m1oligos_5-7nt_m1

k-mer sig=7.74; evalue=1.8e-08

mWCTYCCwGAACCYTCsvrAyC

GRTYBSGARGGTTCWGGRAGWK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mWCTYCCwGAACCYTCsvrAyC

AT1G23810:M09410:TRANSFAC AT1G23810/M09410/TRANSFAC D 17 0.7727 0.732 0.566 NA NA

AT1G23810.DAP:M0720:AthalianaCistrome AT1G23810.DAP/M0720/AthalianaCistrome D 17 0.7727 0.732 0.566 NA NA

HSFC1.ampDAP:M0452:AthalianaCistrome HSFC1.ampDAP/M0452/AthalianaCistrome D 17 0.7727 0.728 0.562 NA NA

Total matches= 30 (27 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 2 oligos_5-7nt_m2oligos_5-7nt_m3

k-mer sig=5.45; evalue=3.5e-06

agcSTTCTAGAAGGsk

MSCCTTCTAGAASGCT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor agcSTTCTAGAAGGsk

HSFB3.ampDAP:M0455:AthalianaCistrome HSFB3.ampDAP/M0455/AthalianaCistrome R 13 0.8125 0.843 0.685 NA NA

HSFA6A:M09236:TRANSFAC HSFA6A/M09236/TRANSFAC D 15 0.8824 0.771 0.681 NA NA

HSFA6A.DAP:M0458:AthalianaCistrome HSFA6A.DAP/M0458/AthalianaCistrome D 15 0.8824 0.771 0.680 NA NA

Total matches= 38 (35 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 3 oligos_5-7nt_m3oligos_5-7nt_m4

k-mer sig=5.05; evalue=8.9e-06

GGTTTCGAAGGTTCAGGAAGAG

CTCTTCCTGAACCTTCGAAACC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor GGTTTCGAAGGTTCAGGAAGAG

HSFA6B.DAP:M0448:AthalianaCistrome HSFA6B.DAP/M0448/AthalianaCistrome D 15 0.6818 0.704 0.480 NA NA

HSFA6B:M09237:TRANSFAC HSFA6B/M09237/TRANSFAC D 15 0.6818 0.704 0.480 NA NA

HSFA6A.ampDAP:M0461:AthalianaCistrome HSFA6A.ampDAP/M0461/AthalianaCistrome R 13 0.5909 0.729 0.431 NA NA

Total matches= 7 (4 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 4 oligos_5-7nt_m4oligos_5-7nt_m5

k-mer sig=5.45; evalue=3.5e-06

ahsCTTCCAGAAGSmk

MKSCTTCTGGAAGSDT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ahsCTTCCAGAAGSmk

HSFB3.ampDAP:M0455:AthalianaCistrome HSFB3.ampDAP/M0455/AthalianaCistrome D 13 0.8125 0.804 0.653 NA NA

HSFA6A:M09236:TRANSFAC HSFA6A/M09236/TRANSFAC D 15 0.8824 0.717 0.633 NA NA

HSFA6A.DAP:M0458:AthalianaCistrome HSFA6A.DAP/M0458/AthalianaCistrome D 15 0.8824 0.716 0.632 NA NA

Total matches= 38 (35 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 5 dyads_test_vs_ctrl_m1dyads_test_vs_ctrl_m1

k-mer sig=12.04; evalue=9.1e-13

kkCTCTrGAAGgk

MCCTTCYAGAGMM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor kkCTCTrGAAGgk

HSFB3.ampDAP:M0455:AthalianaCistrome HSFB3.ampDAP/M0455/AthalianaCistrome R 12 0.8571 0.806 0.691 NA NA

HSFA6A.DAP:M0458:AthalianaCistrome HSFA6A.DAP/M0458/AthalianaCistrome D 13 0.8125 0.816 0.663 NA NA

HSFA6A:M09236:TRANSFAC HSFA6A/M09236/TRANSFAC D 13 0.8125 0.813 0.661 NA NA

Total matches= 38 (35 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 6 dyads_test_vs_ctrl_m2dyads_test_vs_ctrl_m2

k-mer sig=12.04; evalue=9.1e-13

stGGAAbbwtskrGAAGvr

YBCTTCYMSAWVVTTCCAS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor stGGAAbbwtskrGAAGvr

HSFC1.ampDAP:M0452:AthalianaCistrome HSFC1.ampDAP/M0452/AthalianaCistrome R 17 0.8947 0.797 0.713 NA NA

HSFA6A.DAP:M0458:AthalianaCistrome HSFA6A.DAP/M0458/AthalianaCistrome D 16 0.8421 0.831 0.700 NA NA

HSFA6A:M09236:TRANSFAC HSFA6A/M09236/TRANSFAC D 16 0.8421 0.829 0.698 NA NA

Total matches= 42 (39 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 7 dyads_test_vs_ctrl_m3dyads_test_vs_ctrl_m3

k-mer sig=9.04; evalue=9.1e-10

tsGAGArgsyTCGsg

CSCGARSCYTCTCSA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor tsGAGArgsyTCGsg

HSF3.DAP:M0450:AthalianaCistrome HSF3.DAP/M0450/AthalianaCistrome R 12 0.8000 0.769 0.615 NA NA

HSF3:M09232:TRANSFAC HSF3/M09232/TRANSFAC R 12 0.8000 0.768 0.615 NA NA

HSF6.DAP:M0454:AthalianaCistrome HSF6.DAP/M0454/AthalianaCistrome R 12 0.8000 0.761 0.609 NA NA

Total matches= 33 (30 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 8 dyads_test_vs_ctrl_m4dyads_test_vs_ctrl_m4

k-mer sig=12.04; evalue=9.1e-13

rsTCTCyrgarghTTCGrs

SYCGAADCYTCYRGAGASY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rsTCTCyrgarghTTCGrs

HSFA6A:M09236:TRANSFAC HSFA6A/M09236/TRANSFAC R 16 0.8421 0.726 0.612 NA NA

HSFA6A.DAP:M0458:AthalianaCistrome HSFA6A.DAP/M0458/AthalianaCistrome R 16 0.8421 0.725 0.611 NA NA

HSF3:M09232:TRANSFAC HSF3/M09232/TRANSFAC R 12 0.6316 0.893 0.564 NA NA

Total matches= 29 (26 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 9 dyads_test_vs_ctrl_m5dyads_test_vs_ctrl_m5

k-mer sig=12.04; evalue=9.1e-13

gtCGArswrkswrGAAgs

SCTTCYWSMYWSYTCGAC

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor gtCGArswrkswrGAAgs

HSFA6A.DAP:M0458:AthalianaCistrome HSFA6A.DAP/M0458/AthalianaCistrome D 15 0.7895 0.772 0.610 NA NA

HSFA6B:M09237:TRANSFAC HSFA6B/M09237/TRANSFAC D 15 0.8333 0.731 0.609 NA NA

HSFA6A:M09236:TRANSFAC HSFA6A/M09236/TRANSFAC D 15 0.7895 0.771 0.609 NA NA

Total matches= 19 (16 more)

[ match table: html text ]
[ alignments (logos): html text ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus footDB database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J. (2012). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Res 40(4): e31.
Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012). A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets using peak-motifs. Nat Protoc 7(8): 1551-1568.

RSAT - peak-motifs result

Analysis: D5/regulonD5.rm.fna (25/02/2021 19:21)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif comparisons

Logs and parameter files

Publications

Results