peak-motifs W1/regulonW1.rm.fna

Sequence composition (test sequences)

Nb of peaks: 1437
Total seq. size: 931 kb
Min length: 201 bp
Mean length: 647.612 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Sequence composition (ctrl sequences)

Nb of peaks: 34310
Total seq. size: 22214 kb
Min length: 201 bp
Mean length: 647.449 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

motif discovery

oligos_5-7nt

oligos_5-7nt_m1	assembly: tctaaaattttaga (sig=28.17; e-value=6.8e-29)	RC: tctaaaattttaga
oligos_5-7nt_m2	assembly: tctaaaaattttaga (sig=28.17; e-value=6.8e-29)	RC: tctaaaatttttaga
oligos_5-7nt_m3	assembly: ctcccctccgtc (sig=10.81; e-value=1.5e-11)	RC: gacggaggggag
oligos_5-7nt_m4	assembly: cccctccccgaaaattttag (sig=28.17; e-value=6.8e-29)	RC: ctaaaattttcggggagggg
oligos_5-7nt_m5	assembly: tctaaaacggaggggag (sig=13.95; e-value=1.1e-14)	RC: ctcccctccgttttaga

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

dyads_test_vs_ctrl

dyads_test_vs_ctrl_m1	assembly: aaannnnnnnnnnnnnnnnnnnnaaa (sig=11.91; e-value=1.2e-12)	RC: tttnnnnnnnnnnnnnnnnnnnnttt
dyads_test_vs_ctrl_m2	assembly: cccnnnnnnnnnnnnnnnnnccc (sig=11.86; e-value=1.4e-12)	RC: gggnnnnnnnnnnnnnnnnnggg
dyads_test_vs_ctrl_m3	assembly: cccnnnnnnnnnnnnnnnnnnccc (sig=11.86; e-value=1.4e-12)	RC: gggnnnnnnnnnnnnnnnnnnggg
dyads_test_vs_ctrl_m4	assembly: aaannnnnnnnnnnnnnnnnnnnttt (sig=11.86; e-value=1.4e-12)	RC: aaannnnnnnnnnnnnnnnnnnnttt
dyads_test_vs_ctrl_m5	assembly: aaannnnnnnnnnnnnnnnnnaaa (sig=11.86; e-value=1.4e-12)	RC: tttnnnnnnnnnnnnnnnnnnttt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_5-7nt_m1oligos_5-7nt_m1

k-mer sig=28.17; evalue=6.8e-29

wkwcTAAAATTTTAGwww

WWWCTAAAATTTTAGWMW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wkwcTAAAATTTTAGwww

FBP6:M05204:TRANSFAC FBP6/M05204/TRANSFAC R 18 1.0000 0.739 0.739 NA NA

FBP24:M05252:TRANSFAC FBP24/M05252/TRANSFAC R 18 1.0000 0.730 0.730 NA NA

PK22848.1:M0587_1.02:CISBP PK22848.1/M0587_1.02/CISBP R 13 0.7222 0.817 0.590 NA NA

Total matches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 2 oligos_5-7nt_m2oligos_5-7nt_m2

k-mer sig=28.17; evalue=6.8e-29

twTCTAAAAATTTTAGwdA

THWCTAAAATTTTTAGAWA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor twTCTAAAAATTTTAGwdA

PK22848.1:M0587_1.02:CISBP PK22848.1/M0587_1.02/CISBP D 13 0.6842 0.832 0.569 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Motif 3 oligos_5-7nt_m3oligos_5-7nt_m3

k-mer sig=10.81; evalue=1.5e-11

yyCTCCCCTCCGtcys

SRGACGGAGGGGAGRR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yyCTCCCCTCCGtcys

EDF3:M05120:TRANSFAC EDF3/M05120/TRANSFAC R 9 0.5625 0.747 0.420 NA NA

RAV2:M04996:TRANSFAC RAV2/M04996/TRANSFAC R 9 0.5625 0.728 0.409 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Motif 4 oligos_5-7nt_m4oligos_5-7nt_m5

k-mer sig=28.17; evalue=6.8e-29

TTTCTAAAryCGAGkGGrGAm

KTCYCCMCTCGRYTTTAGAAA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TTTCTAAAryCGAGkGGrGAm

Total matches= 0

No match

Motif 5 dyads_test_vs_ctrl_m1dyads_test_vs_ctrl_m1

k-mer sig=11.91; evalue=1.2e-12

wwAAAwwwwwwwwwwwwwwwwwwwwAAAww

WWTTTWWWWWWWWWWWWWWWWWWWWTTTWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwAAAwwwwwwwwwwwwwwwwwwwwAAAww

Total matches= 0

No match

Motif 6 dyads_test_vs_ctrl_m2dyads_test_vs_ctrl_m2

k-mer sig=11.86; evalue=1.4e-12

mcCCChysycyyymwwwychwyCCCms

SKGGGRWDGRWWWKRRRGRSRDGGGGK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mcCCChysycyyymwwwychwyCCCms

Total matches= 0

No match

Motif 7 dyads_test_vs_ctrl_m3dyads_test_vs_ctrl_m3

k-mer sig=11.86; evalue=1.4e-12

hyCCCmwcyycymywwwychwwyCCCam

KTGGGRWWDGRWWWRKRGRRGWKGGGRD

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hyCCCmwcyycymywwwychwwyCCCam

Total matches= 0

No match

Motif 8 dyads_test_vs_ctrl_m4dyads_test_vs_ctrl_m4

k-mer sig=11.86; evalue=1.4e-12

wwAAAwwwwwwwwwwwwwwwwwwwwTTTww

WWAAAWWWWWWWWWWWWWWWWWWWWTTTWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwAAAwwwwwwwwwwwwwwwwwwwwTTTww

At4g38000.DAP:M0270:AthalianaCistrome At4g38000.DAP/M0270/AthalianaCistrome D 21 0.5676 0.712 0.404 NA NA

At4g38000:M09124:TRANSFAC At4g38000/M09124/TRANSFAC D 21 0.5676 0.711 0.404 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Motif 9 dyads_test_vs_ctrl_m5dyads_test_vs_ctrl_m5

k-mer sig=11.86; evalue=1.4e-12

wwAAAwdwwwwwwwwwwwwwwwAAAAww

WWTTTTWWWWWWWWWWWWWWWHWTTTWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwAAAwdwwwwwwwwwwwwwwwAAAAww

At4g38000.DAP:M0270:AthalianaCistrome At4g38000.DAP/M0270/AthalianaCistrome R 27 0.9310 0.709 0.660 NA NA

At4g38000:M09124:TRANSFAC At4g38000/M09124/TRANSFAC R 27 0.9310 0.707 0.659 NA NA

OBP3.ampDAP:M0274:AthalianaCistrome OBP3.ampDAP/M0274/AthalianaCistrome R 18 0.6207 0.726 0.451 NA NA

Total matches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus footDB database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: W1/regulonW1.rm.fna (18/02/2021 11:16)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor twTCTAAAAATTTTAGwdA

PK22848.1:M0587_1.02:CISBP PK22848.1/M0587_1.02/CISBP D 13 0.6842 0.832 0.569 NA NA

Total matches= 1

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TTTCTAAAryCGAGkGGrGAm

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwAAAwwwwwwwwwwwwwwwwwwwwAAAww

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mcCCChysycyyymwwwychwyCCCms

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hyCCCmwcyycymywwwychwwyCCCam

Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: W1/regulonW1.rm.fna (18/02/2021 11:16)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor twTCTAAAAATTTTAGwdA PK22848.1:M0587_1.02:CISBP PK22848.1/M0587_1.02/CISBP D 13 0.6842 0.832 0.569 NA NA Total matches= 1

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor yyCTCCCCTCCGtcys EDF3:M05120:TRANSFAC EDF3/M05120/TRANSFAC R 9 0.5625 0.747 0.420 NA NA RAV2:M04996:TRANSFAC RAV2/M04996/TRANSFAC R 9 0.5625 0.728 0.409 NA NA Total matches= 2

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor TTTCTAAAryCGAGkGGrGAm Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor wwAAAwwwwwwwwwwwwwwwwwwwwAAAww Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor mcCCChysycyyymwwwychwyCCCms Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor hyCCCmwcyycymywwwychwwyCCCam Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor twTCTAAAAATTTTAGwdA

PK22848.1:M0587_1.02:CISBP PK22848.1/M0587_1.02/CISBP D 13 0.6842 0.832 0.569 NA NA

Total matches= 1

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor TTTCTAAAryCGAGkGGrGAm

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wwAAAwwwwwwwwwwwwwwwwwwwwAAAww

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mcCCChysycyyymwwwychwyCCCms

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor hyCCCmwcyycymywwwychwwyCCCam

Total matches= 0