peak-motifs W2/regulonW2.rm.fna

Sequence composition (test sequences)

Nb of peaks: 728
Total seq. size: 455 kb
Min length: 201 bp
Mean length: 625.011 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Sequence composition (ctrl sequences)

Nb of peaks: 34310
Total seq. size: 22214 kb
Min length: 201 bp
Mean length: 647.449 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Motif discovery

Motif 1 oligos_5-7nt_m1oligos_5-7nt_m1

k-mer sig=96.71; evalue=1.9e-97

yrGaTGGGCCCAtCtr

YAGATGGGCCCATCYR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor yrGaTGGGCCCAtCtr

At2g45680:M09587:TRANSFAC At2g45680/M09587/TRANSFAC R 11 0.6875 0.818 0.562 NA NA

TCP11:M01850:TRANSFAC TCP11/M01850/TRANSFAC D 12 0.7500 0.711 0.534 NA NA

TCP2:M08152:TRANSFAC TCP2/M08152/TRANSFAC D 10 0.6250 0.840 0.525 NA NA

Total matches= 40 (37 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 2 oligos_5-7nt_m2oligos_5-7nt_m3

k-mer sig=91.32; evalue=4.8e-92

mmAAGCCCATCwv

BWGATGGGCTTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mmAAGCCCATCwv

HAP3.DAP:M0352:AthalianaCistrome HAP3.DAP/M0352/AthalianaCistrome D 8 0.5714 0.707 0.404 NA NA

HAP3:M09184:TRANSFAC HAP3/M09184/TRANSFAC D 8 0.5714 0.707 0.404 NA NA

Total matches= 2

[ match table: html text ]
[ alignments (logos): html text ]

Motif 3 oligos_5-7nt_m3oligos_5-7nt_m4

k-mer sig=96.71; evalue=1.9e-97

CGGCGGGGCACAAACCCTAGGGGT

ACCCCTAGGGTTTGTGCCCCGCCG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CGGCGGGGCACAAACCCTAGGGGT

MADS1:M05266:TRANSFAC MADS1/M05266/TRANSFAC R 15 0.5000 0.885 0.443 NA NA

Total matches= 1

[ match table: html text ]
[ alignments (logos): html text ]

Motif 4 oligos_5-7nt_m4oligos_5-7nt_m5

k-mer sig=96.71; evalue=1.9e-97

mmAGGCCCATCwv

BWGATGGGCCTKK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor mmAGGCCCATCwv

At2g20350:M05132:TRANSFAC At2g20350/M05132/TRANSFAC D 10 0.7692 0.766 0.590 NA NA

TCP11:M01850:TRANSFAC TCP11/M01850/TRANSFAC R 11 0.7857 0.743 0.584 NA NA

AIL6:M03191:TRANSFAC AIL6/M03191/TRANSFAC R 10 0.7692 0.745 0.573 NA NA

Total matches= 8 (5 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 5 dyads_test_vs_ctrl_m1dyads_test_vs_ctrl_m1

k-mer sig=92.22; evalue=6e-93

msaGscCCAAAACCCTAGcsm

KSGCTAGGGTTTTGGGSCTSK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor msaGscCCAAAACCCTAGcsm

AT1G72740:M09328:TRANSFAC AT1G72740/M09328/TRANSFAC D 15 0.7143 0.821 0.586 NA NA

AT1G72740:MA1353.1:JASPAR AT1G72740/MA1353.1/JASPAR D 15 0.7143 0.820 0.586 NA NA

AT1G72740.ampDAP:M0588:AthalianaCistrome AT1G72740.ampDAP/M0588/AthalianaCistrome R 14 0.5000 0.850 0.425 NA NA

Total matches= 5 (2 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 6 dyads_test_vs_ctrl_m2dyads_test_vs_ctrl_m2

k-mer sig=79.15; evalue=7.1e-80

ryaGGCCcAarGCCCAtstv

BASATGGGCYTTGGGCCTRY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ryaGGCCcAarGCCCAtstv

Total matches= 0

No match

Motif 7 dyads_test_vs_ctrl_m3dyads_test_vs_ctrl_m3

k-mer sig=79.15; evalue=7.1e-80

ymCGGCCCAkw

WMTGGGCCGKR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ymCGGCCCAkw

At2g45680:M09587:TRANSFAC At2g45680/M09587/TRANSFAC D 11 1.0000 0.742 0.742 NA NA

TCP11:M01850:TRANSFAC TCP11/M01850/TRANSFAC R 11 0.9167 0.800 0.733 NA NA

AIL6:M03191:TRANSFAC AIL6/M03191/TRANSFAC R 10 0.9091 0.738 0.671 NA NA

Total matches= 53 (50 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 8 dyads_test_vs_ctrl_m4dyads_test_vs_ctrl_m4

k-mer sig=18.99; evalue=1e-19

cccCCsCCGCCGCCGcc

GGCGGCGGCGGSGGGGG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor cccCCsCCGCCGCCGcc

AT4G18450:MA1228.1:JASPAR AT4G18450/MA1228.1/JASPAR R 16 0.8889 0.915 0.813 NA NA

AT4G18450:M09033:TRANSFAC AT4G18450/M09033/TRANSFAC R 16 0.8889 0.915 0.813 NA NA

ERF8.DAP:M0044:AthalianaCistrome ERF8.DAP/M0044/AthalianaCistrome D 15 0.8824 0.917 0.809 NA NA

Total matches= 284 (281 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 9 dyads_test_vs_ctrl_m5dyads_test_vs_ctrl_m5

k-mer sig=79.15; evalue=7.1e-80

wrATGGGCCdk

MHGGCCCATYW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor wrATGGGCCdk

At2g20350:M05132:TRANSFAC At2g20350/M05132/TRANSFAC R 10 0.9091 0.759 0.690 NA NA

TCP3:M1645_1.02:CISBP TCP3/M1645_1.02/CISBP R 10 0.9091 0.706 0.642 NA NA

At2g45680:M09587:TRANSFAC At2g45680/M09587/TRANSFAC R 10 0.8333 0.746 0.622 NA NA

Total matches= 15 (12 more)

[ match table: html text ]
[ alignments (logos): html text ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus footDB database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J. (2012). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Res 40(4): e31.
Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012). A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets using peak-motifs. Nat Protoc 7(8): 1551-1568.

RSAT - peak-motifs result

Analysis: W2/regulonW2.rm.fna (18/02/2021 11:16)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CGGCGGGGCACAAACCCTAGGGGT

MADS1:M05266:TRANSFAC MADS1/M05266/TRANSFAC R 15 0.5000 0.885 0.443 NA NA

Total matches= 1

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ryaGGCCcAarGCCCAtstv

Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: W2/regulonW2.rm.fna (18/02/2021 11:16)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor CGGCGGGGCACAAACCCTAGGGGT MADS1:M05266:TRANSFAC MADS1/M05266/TRANSFAC R 15 0.5000 0.885 0.443 NA NA Total matches= 1

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor ryaGGCCcAarGCCCAtstv Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor CGGCGGGGCACAAACCCTAGGGGT

MADS1:M05266:TRANSFAC MADS1/M05266/TRANSFAC R 15 0.5000 0.885 0.443 NA NA

Total matches= 1

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ryaGGCCcAarGCCCAtstv

Total matches= 0