peak-motifs W6/regulonW6.rm.fna

Sequence composition (test sequences)

Nb of peaks: 358
Total seq. size: 239 kb
Min length: 201 bp
Mean length: 667.145 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Sequence composition (ctrl sequences)

Nb of peaks: 34310
Total seq. size: 22214 kb
Min length: 201 bp
Mean length: 647.449 bp
Max length: 701 bp [ seq: converted purged ]
[ lengths: list distrib graph ]

Nucleotide composition profiles

Transition frequencies
Position profiles

[ 1nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Dinucleotide composition profiles

Transition frequencies
Position profiles

[ 2nt: freq transitions ]
[ bg model: Inclusive format ]
[ profile: table html(individual) ]

Motif discovery

Motif 1 oligos_5-7nt_m1oligos_5-7nt_m1

k-mer sig=10.96; evalue=1.1e-11

ywCCACACCAACCmmm

KKKGGTTGGTGTGGWR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ywCCACACCAACCmmm

MYB58.DAP:M0523:AthalianaCistrome MYB58.DAP/M0523/AthalianaCistrome R 15 0.9375 0.810 0.759 NA NA

MYB58:M09307:TRANSFAC MYB58/M09307/TRANSFAC R 15 0.9375 0.809 0.758 NA NA

MYB55:M09304:TRANSFAC MYB55/M09304/TRANSFAC D 14 0.8750 0.804 0.703 NA NA

Total matches= 73 (70 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 2 oligos_5-7nt_m2oligos_5-7nt_m2

k-mer sig=6.78; evalue=1.7e-07

AACCCCACCGACAGTCCGGAC

GTCCGGACTGTCGGTGGGGTT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor AACCCCACCGACAGTCCGGAC

At1g22810.ampDAP:M0056:AthalianaCistrome At1g22810.ampDAP/M0056/AthalianaCistrome D 15 0.7143 0.727 0.519 NA NA

At2g44940:M09040:TRANSFAC At2g44940/M09040/TRANSFAC R 15 0.7143 0.726 0.519 NA NA

AT2G44940:MA1229.1:JASPAR AT2G44940/MA1229.1/JASPAR R 15 0.7143 0.725 0.518 NA NA

Total matches= 45 (42 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 3 oligos_5-7nt_m3oligos_5-7nt_m3

k-mer sig=6.78; evalue=1.7e-07

ssyCACACGTGTGrsr

YSYCACACGTGTGRSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssyCACACGTGTGrsr

At4g36780.ampDAP:M0238:AthalianaCistrome At4g36780.ampDAP/M0238/AthalianaCistrome R 14 0.8750 0.888 0.777 NA NA

BAM8.DAP:M0154:AthalianaCistrome BAM8.DAP/M0154/AthalianaCistrome R 14 0.8235 0.886 0.730 NA NA

BAM8:M09106:TRANSFAC BAM8/M09106/TRANSFAC R 14 0.8235 0.886 0.730 NA NA

Total matches= 89 (86 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 4 oligos_5-7nt_m4oligos_5-7nt_m4

k-mer sig=10.96; evalue=1.1e-11

ytgCyACCAACCAvm

KBTGGTTGGTRGCAR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ytgCyACCAACCAvm

MYB58.DAP:M0523:AthalianaCistrome MYB58.DAP/M0523/AthalianaCistrome R 15 1.0000 0.837 0.837 NA NA

MYB58:M09307:TRANSFAC MYB58/M09307/TRANSFAC R 15 1.0000 0.836 0.836 NA NA

ATY13.ampDAP:M0537:AthalianaCistrome ATY13.ampDAP/M0537/AthalianaCistrome D 15 1.0000 0.827 0.827 NA NA

Total matches= 129 (126 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 5 oligos_5-7nt_m5oligos_5-7nt_m5

k-mer sig=1.55; evalue=0.028

awAATTTAww

WWTAAATTWT

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor awAATTTAww

SHP2:M05200:TRANSFAC SHP2/M05200/TRANSFAC D 10 0.9091 0.796 0.723 NA NA

At1g76110.DAP:M0146:AthalianaCistrome At1g76110.DAP/M0146/AthalianaCistrome D 10 0.9091 0.792 0.720 NA NA

At1g76110:M09102:TRANSFAC At1g76110/M09102/TRANSFAC D 10 0.9091 0.792 0.720 NA NA

Total matches= 59 (56 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 6 dyads_test_vs_ctrl_m1dyads_test_vs_ctrl_m1

k-mer sig=10.48; evalue=3.3e-11

ywCCACCAACCACaCcwmm

KKWGGTGTGGTTGGTGGWR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ywCCACCAACCACaCcwmm

MYB13.ampDAP:M0538:AthalianaCistrome MYB13.ampDAP/M0538/AthalianaCistrome D 18 0.9474 0.853 0.808 NA NA

MYB58.ampDAP:M0497:AthalianaCistrome MYB58.ampDAP/M0497/AthalianaCistrome R 19 0.9048 0.838 0.758 NA NA

MYB83.ampDAP:M0500:AthalianaCistrome MYB83.ampDAP/M0500/AthalianaCistrome R 15 0.7895 0.861 0.680 NA NA

Total matches= 57 (54 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 7 dyads_test_vs_ctrl_m2dyads_test_vs_ctrl_m2

k-mer sig=3.71; evalue=0.00019

rcACACACrCACry

RYGTGYGTGTGTGY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rcACACACrCACry

Total matches= 0

No match

Motif 8 dyads_test_vs_ctrl_m3dyads_test_vs_ctrl_m3

k-mer sig=10.48; evalue=3.3e-11

cmAACCAACCCmm

KKGGGTTGGTTKG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor cmAACCAACCCmm

MYB58.DAP:M0523:AthalianaCistrome MYB58.DAP/M0523/AthalianaCistrome R 13 0.8667 0.769 0.667 NA NA

MYB58:M09307:TRANSFAC MYB58/M09307/TRANSFAC R 13 0.8667 0.769 0.667 NA NA

MYB83:M09319:TRANSFAC MYB83/M09319/TRANSFAC R 11 0.8462 0.783 0.662 NA NA

Total matches= 86 (83 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 9 dyads_test_vs_ctrl_m4dyads_test_vs_ctrl_m4

k-mer sig=10.48; evalue=3.3e-11

ssCACcmAcCCAcc

GGTGGGTKGGTGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor ssCACcmAcCCAcc

MYB13.DAP:M0534:AthalianaCistrome MYB13.DAP/M0534/AthalianaCistrome R 14 0.9333 0.782 0.730 NA NA

MYB13:M09287:TRANSFAC MYB13/M09287/TRANSFAC R 14 0.9333 0.781 0.729 NA NA

AtMYB-84:M00970:TRANSFAC AtMYB-84/M00970/TRANSFAC R 13 0.9286 0.720 0.668 NA NA

Total matches= 61 (58 more)

[ match table: html text ]
[ alignments (logos): html text ]

Motif 10 dyads_test_vs_ctrl_m5dyads_test_vs_ctrl_m5

k-mer sig=10.48; evalue=3.3e-11

rgAAAbbwrsktsbrhmrvcrmrmrACGrr

YYCGTYKYKYGBYKDYVSAMSYWVVTTTCY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rgAAAbbwrsktsbrhmrvcrmrmrACGrr

Total matches= 0

No match

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]
Discovered motifs versus transcription factor databases
Motifs versus footDB database		[ table: html txt ] [ alignments (logo): html text ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

Thomas-Chollier M, Herrmann C, Defrance M, Sand O, Thieffry D, van Helden J. (2012). RSAT peak-motifs: motif analysis in full-size ChIP-seq datasets. Nucleic Acids Res 40(4): e31.
Thomas-Chollier M, Darbo E, Herrmann C, Defrance M, Thieffry D, van Helden J. (2012). A complete workflow for the analysis of full-size ChIP-seq (and similar) data sets using peak-motifs. Nat Protoc 7(8): 1551-1568.

RSAT - peak-motifs result

Analysis: W6/regulonW6.rm.fna (18/02/2021 11:16)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rcACACACrCACry

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rgAAAbbwrsktsbrhmrvcrmrmrACGrr

Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

RSAT - peak-motifs result

Analysis: W6/regulonW6.rm.fna (18/02/2021 11:16)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor rcACACACrCACry Total matches= 0

footDB name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match columns aligned correlation cor rgAAAbbwrsktsbrhmrvcrmrmrACGrr Total matches= 0

Motif comparisons

Logs and parameter files

Publications

Results

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rcACACACrCACry

Total matches= 0

footDB

name id strand Nb overlap % Pearson Normalized aligned col. motif aligned col. match

columns aligned correlation cor rgAAAbbwrsktsbrhmrvcrmrmrACGrr

Total matches= 0