peak-motifs flag

motif discovery

oligos_6nt_mkv4

oligos_6nt_mkv4_m1	assembly: gccaggacctg (sig=62.98; e-value=1e-63)	RC: caggtcctggc
oligos_6nt_mkv4_m2	assembly: cgcccg (sig=22.58; e-value=2.6e-23)	RC: cgggcg
oligos_6nt_mkv4_m3	assembly: agacca (sig=16.95; e-value=1.1e-17)	RC: tggtct
oligos_6nt_mkv4_m4	assembly: ctcctc (sig=16.78; e-value=1.7e-17)	RC: gaggag
oligos_6nt_mkv4_m5	assembly: tggaca (sig=16.17; e-value=6.8e-17)	RC: tgtcca

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_6nt

positions_6nt_m1	assembly: gcaggtcctgccaggacctg (sig=51.51; e-value=3.1e-52)	RC: caggtcctggcaggacctgc
positions_6nt_m2	assembly: gcaggtcctgccaggaccct (sig=51.51; e-value=3.1e-52)	RC: agggtcctggcaggacctgc
positions_6nt_m3	assembly: tggcaggtcctgccaggact (sig=51.51; e-value=3.1e-52)	RC: agtcctggcaggacctgcca
positions_6nt_m4	assembly: aaggacctgccaggact (sig=51.51; e-value=3.1e-52)	RC: agtcctggcaggtcctt
positions_6nt_m5	assembly: agctgc (sig=3.47; e-value=0.00034)	RC: gcagct

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

oligos_7nt_mkv5

oligos_7nt_mkv5_m1	assembly: tccaggacctgg (sig=26.18; e-value=6.6e-27)	RC: ccaggtcctgga
oligos_7nt_mkv5_m2	assembly: atttttaa (sig=21.61; e-value=2.5e-22)	RC: ttaaaaat
oligos_7nt_mkv5_m3	assembly: tggacca (sig=11.92; e-value=1.2e-12)	RC: tggtcca
oligos_7nt_mkv5_m4	assembly: tgaggaca (sig=11.10; e-value=7.9e-12)	RC: tgtcctca
oligos_7nt_mkv5_m5	assembly: ctggaag (sig=11.05; e-value=8.9e-12)	RC: cttccag

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

positions_7nt

positions_7nt_m1	assembly: cctgccaggacctgg (sig=26.11; e-value=7.8e-27)	RC: ccaggtcctggcagg
positions_7nt_m2	assembly: cctgccaggaccca (sig=24.16; e-value=6.9e-25)	RC: tgggtcctggcagg
positions_7nt_m3	assembly: agtcctggcagg (sig=15.95; e-value=1.1e-16)	RC: cctgccaggact
positions_7nt_m4	assembly: gcaggacctgg (sig=26.11; e-value=7.8e-27)	RC: ccaggtcctgc
positions_7nt_m5	assembly: acaggacctgg (sig=26.11; e-value=7.8e-27)	RC: ccaggtcctgt

[ discovered words: text ]
[ assembly: text sig matrices ]
[ matrices: tab format transfac format ]

Motif discovery

Motif 1 oligos_6nt_mkv4_m1

k-mer sig=62.98; evalue=1e-63

ctgcCAGGACCTggs

SCCAGGTCCTGGCAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2637 (26.68%)
Max nb of predicted sites per peak: 49
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.53

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 2 oligos_6nt_mkv4_m2

k-mer sig=22.58; evalue=2.6e-23

ssCGCCCGss

SSCGGGCGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1190 (12.04%)
Max nb of predicted sites per peak: 33
(chr17:63556711-63558197)
Mean nb of predicted sites per peak: 3.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 3 oligos_6nt_mkv4_m3

k-mer sig=16.95; evalue=1.1e-17

mgAGACCAsv

BSTGGTCTCK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1032 (10.44%)
Max nb of predicted sites per peak: 4
(chr19:54483723-54484880)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 4 oligos_6nt_mkv4_m4

k-mer sig=16.78; evalue=1.7e-17

ysCTCCTCcs

SGGAGGAGSR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1058 (10.70%)
Max nb of predicted sites per peak: 8
(chr17:63133244-63133427)
Mean nb of predicted sites per peak: 1.30

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 5 oligos_6nt_mkv4_m5

k-mer sig=16.17; evalue=6.8e-17

yvTGGACAbr

YVTGTCCABR

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 761 (7.70%)
Max nb of predicted sites per peak: 4
(chr2:224128026-224128292)
Mean nb of predicted sites per peak: 1.08

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 6 positions_6nt_m1

k-mer sig=51.51; evalue=3.1e-52

ssscaGGtCCTGcCAGGaCCtgss

SSCAGGTCCTGGCAGGACCTGSSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1251 (12.66%)
Max nb of predicted sites per peak: 27
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.78

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 7 positions_6nt_m2

k-mer sig=51.51; evalue=3.1e-52

ssccaGGtCCTGsCAGGaCCykgs

SCMRGGTCCTGSCAGGACCTGGSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1338 (13.54%)
Max nb of predicted sites per peak: 23
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.79

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 8 positions_6nt_m3

k-mer sig=51.51; evalue=3.1e-52

sskgsCAGGTCCTGsCAGGaCysg

CSRGTCCTGSCAGGACCTGSCMSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1649 (16.68%)
Max nb of predicted sites per peak: 51
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.48

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 9 positions_6nt_m4

k-mer sig=51.51; evalue=3.1e-52

kcmAGGaCCTGcCAGGACyyk

MRRGTCCTGGCAGGTCCTKGM

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1257 (12.72%)
Max nb of predicted sites per peak: 34
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.42

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 10 positions_6nt_m5

k-mer sig=3.47; evalue=0.00034

ssAGCTGCsg

CSGCAGCTSS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 999 (10.11%)
Max nb of predicted sites per peak: 7
(chr4:56212096-56212779)
Mean nb of predicted sites per peak: 1.41

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 11 oligos_7nt_mkv5_m1

k-mer sig=26.18; evalue=6.6e-27

cttCCAGGACCTGgsa

TSCCAGGTCCTGGAAG

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2461 (24.90%)
Max nb of predicted sites per peak: 45
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.52

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 12 oligos_7nt_mkv5_m2

k-mer sig=21.61; evalue=2.5e-22

wwATTTTTAwww

WWWTAAAAATWW

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1443 (14.60%)
Max nb of predicted sites per peak: 10
(chr1:236252733-236253886)
Mean nb of predicted sites per peak: 1.32

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 13 oligos_7nt_mkv5_m3

k-mer sig=11.92; evalue=1.2e-12

rvTGGACCAba

TVTGGTCCABY

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 323 (3.27%)
Max nb of predicted sites per peak: 2
(chr8:8126705-8127248)
Mean nb of predicted sites per peak: 1.02

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 14 oligos_7nt_mkv5_m4

k-mer sig=11.10; evalue=7.9e-12

bsTGAGGACAgr

YCTGTCCTCASV

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 424 (4.29%)
Max nb of predicted sites per peak: 8
(chr16:83691983-83692232)
Mean nb of predicted sites per peak: 1.04

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 15 oligos_7nt_mkv5_m5

k-mer sig=11.05; evalue=8.9e-12

tcCTGGAAGrr

YYCTTCCAGGA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 1416 (14.32%)
Max nb of predicted sites per peak: 17
(chr8:1411142-1413054)
Mean nb of predicted sites per peak: 1.12

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 16 positions_7nt_m1

k-mer sig=26.11; evalue=7.8e-27

smsCtgCCAGGACCTGgsv

BSCCAGGTCCTGGCAGSKS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2600 (26.30%)
Max nb of predicted sites per peak: 33
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.44

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 17 positions_7nt_m2

k-mer sig=24.16; evalue=6.9e-25

smsCtgCCAGGACCygss

SSCRGGTCCTGGCAGSKS

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2608 (26.38%)
Max nb of predicted sites per peak: 30
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.34

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 18 positions_7nt_m3

k-mer sig=15.95; evalue=1.1e-16

mrrGTCCTGGCaGsks

SMSCTGCCAGGACYYK

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2359 (23.86%)
Max nb of predicted sites per peak: 17
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.19

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 19 positions_7nt_m4

k-mer sig=26.11; evalue=7.8e-27

tksCAGGACCTGgsr

YSCCAGGTCCTGSMA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2180 (22.05%)
Max nb of predicted sites per peak: 48
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.69

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Motif 20 positions_7nt_m5

k-mer sig=26.11; evalue=7.8e-27

tkmCAGGACCTGgsa

TSCCAGGTCCTGKMA

[ k-mers: statistics assemblies ]
[ matrix: tab_format transfac_format ]

Predicted sites on test peaks

Distribution of sites

Nb of predicted sites per peak

Nb peaks with at least one predicted site: 2203 (22.29%)
Max nb of predicted sites per peak: 29
(chr8:1298525-1299518)
Mean nb of predicted sites per peak: 1.68

[ sites: text ]
[ distribution: text ]
[ sites per peak: text ]
[ enrichment: text graph ]

Word significance table
Word comparisons		[tab] [html] [heatmap]
Comparisons between discovered motifs
Discovered motifs versus discovered motifs		[ Discovered motif(s): tf ] [ table: html txt ] [ alignments (logo): html text ] [ clustering: html ] [ graph: gml (for CytoScape) ]

Log files
Parameters and files		[txt] [html]
Time log		[time table] [time log] [html]

RSAT - peak-motifs result

Analysis: flag (25/11/2025 16:43)

Command

Sequence composition

Discovered motifs (by algorithm)

Discovered motifs (with motif comparison)

Motif locations (sites)

Motif comparisons

Logs and parameter files

Publications

Results